| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ANIMAL NUTRITION |
* Department of Animal Sciences, and
Department of Foods and Nutrition, Purdue University, West Lafayette, IN 47907
 |
Abstract |
|---|
 Top Abstract INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
0.05) with DDGS feeding and were 65.07, 69.75, and 74.25 for 0, 20, and 40% DDGS, respectively. Addition of CLA decreased (P 0.05) outer layer backfat iodine values from 71.11 to 68.31. Diets containing DDGS decreased (P 0.05) percent lean tissue contained in bacon from 48% for controls to 38% for pigs fed 40%. Abundance of fatty acid synthase, carnitine palmitoyl transferase Ia, acetyl-CoA-carboxylase, stearoyl-CoA desaturase, and glycerol-3-phosphate dehydrogenase mRNA in adipose or liver were not different (P > 0.05) for pigs fed DDGS. Feeding CLA decreased (P 0.05) the 
9 de-saturase index in adipose tissue. The data indicate that decreased carcass firmness with DDGS feeding is not reflected by changes in lipogenic gene expression. Feeding 20% or more DDGS to finishing swine decreases bacon leanness, but inclusion of 0.6% CLA in the finishing diet can partially reverse these effects.
Key Words: conjugated linoleic acid • distiller grain • pork quality • swine
|
INTRODUCTION |
|---|
|
TopAbstractINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
). Available data indicate that source of dietary fat influences the ratio of SFA to unsaturated fatty acids in carcass lipids (Azain, 2001). Because dried corn distillers grains with solubles (DDGS) contain 10 to 15% lipids (Rausch and Belyea, 2006) and a high proportion of unsaturated fatty acids, there may be adverse effects of diets containing DDGS on pork quality.
Conjugated linoleic acids are a group of positional and geometric isomers of linoleic acid (18:2). Feeding CLA increases the proportion of SFA and, consequently, backfat and belly firmness (Ostrowska et al., 1999; Eggert et al., 2001; Dugan et al., 2004). Although CLA inhibits fatty acid synthase (FAS) and acetyl-CoA carboxylase (ACC) and depresses de novo lipogenesis (Ostrowska et al., 1999; House et al., 2005), it appears to act to increase belly firmness and pork quality by decreasing stearoyl-CoA desaturase (SCD-1) gene expression (Demaree et al., 2002; Smith et al., 2002). Consequently there is decreased conversion of SFA to unsaturated fatty acids and increased carcass firmness (Dobrzyn and Ntambi, 2005).
We hypothesized that diets containing DDGS would reduce pork quality in a dose-responsive manner and that CLA would act to ameliorate these effects. Therefore, the objectives of this study were to examine the impact of feeding 3 concentrations of DDGS (0, 20, and 40%) and 2 concentrations of CLA (0, 0.6%) and their combinations on carcass fat characteristics, bacon quality, and expression of key genes for lipid metabolism in grow-finish pigs.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Animal Handling and Diets
Thirty-six market gilts were selected from the Purdue University swine herd and individually housed in 2.44 x 2.44 m pens. Before initiation of the experiment reported, pigs were fed a diet containing corn (89%), soybean meal (7.5%), choice white grease (1%), and lysine (0.70%). Pigs were weighed at receipt and were randomly allocated to receive a corn-soybean-based diet (Table 1) containing 0, 20, or 40% DDGS and 0 or 0.6% CLA in a 2 x 3 factorial arrangement of treatments. Base diets were sampled at the beginning of the experiment, and chemical analysis (Table 1) was conducted by Experiment Station Chemical Laboratories (Columbia, MO) using wet chemistry methods. Diet fatty acid profiles (Table 2) were determined using a chloroform-methanol extraction followed by sodium methoxide catalysis (Li and Watkins, 2001) and analyzed using the gas-liquid chromatograph conditions described below. During d 0 through 20, pigs received diets containing 0, 20, or 40% DDGS. On d 21 and continuing through the end of the experiment, one-half of the pigs within each DDGS group also received 0.6% CLA (1% inclusion of 0.6% CLA product, BASF Corporation, Florham Park, NJ), and the other one-half received 1% choice white grease to maintain equal dietary fat inclusion among treatments. Profile of CLA product was 28% cis-9, trans-11 CLA (min), 28% trans-10, cis-11 CLA (min), less than 35% oleic, palmitic, stearic, and linoleic acids (remainder from conjugation of sunflower oil). Pigs were given ad libitum access to feed, and diets were formulated to meet or exceed NRC requirements for swine (NRC, 1998). Body weight and feed intake were recorded for each pig on 1, 10, 20, and 30 d of the experiment.
|
|
), loin drip loss, and belly bend values were determined 24 h after slaughter. Fatty acid distribution of middle and outer layers of backfat from posterior of the right shoulder, and belly fat from the 10th rib, right of the midline, were determined by GLC. Hydroxyproline content of belly fat was measured as described below. Carcass Characteristics
Water-holding capacity of loin chops was determined from a 2.54-cm core taken from the 10th rib chop of the left carcass (Rasmussen and Stouffer, 1996). Briefly, the muscle core sample was weighed into a collection tube and stored at 4 °C for 24 h. The muscle was then removed and the exudate measured (Rasmussen and Stouffer, 1996).
Bellies were removed anterior to the 10th rib, trimmed, weighed, and thickness determined at the 10th-rib corners. Bellies were centered on a 2.54-cm bar, and bend from the horizontal plane was determined after 1 min. The percent bend was calculated as absolute bend divided by weight of the trimmed belly multiplied by 100. Relative bend was calculated as absolute bend divided by average thickness of the belly multiplied by 100 (Eggert et al., 2001). Hydroxyproline content of belly fat was measured according to Woessner (1961). Collagen content was calculated assuming 12.5% hydroxyproline content of collagen (Woessner, 1961).
Analysis of Fatty Acid Profile
Fatty acid profiles were determined for belly fat, outer layer backfat, and middle layer backfat. Fatty acid methyl esters prepared using the alternate method for fats and oils (IUPAC, 1987). A 200-mg sample of each fat depot was minced and combined with 2 mL of hexane and 0.1 mL of 2 N methanolic KOH, vortexed for 2 min, and centrifuged at 1,850 x g for 20 min at 4 °C. A 50-µL aliquot of the supernatant was diluted with 0.95 mL of hexane. The profile of fatty acids was determined by GLC using a Varian 3900 gas-liquid chromatograph equipped with an 8400 autosampler and wall coated open tubular fused silica 30 m x 0.32 mm capillary-channel polymer wax 52 chemically bonded column (Varion Inc., Palo Alto, CA) using helium as a carrier gas (28 mL/min) and a flame-ionization detector. An initial oven temperature of 175°C was increased by 3°C/min until 240°C was reached. A volume of 5 µL of sample was injected into the chamber and mixed with helium at a 1:100 dilution rate and a PUFA-3 standard (Sigma-Aldrich, St. Louis, MO) was used. Chromatographic profiles were evaluated for main fatty acid peak strengths. Samples that did not meet concentration criteria were adjusted by varying the amount of hexane to sample ratio and were reanalyzed.
Iodine value (IV; Madsen et al., 1992) was calculated as described by AOAC (1990). The n-6 to n-3 ratios were calculated as described by Gordon et al. (2005). The 9 desaturase index, an estimator of SCD-1 activity, was calculated as described by Smith et al. (2002).
Bacon Analysis
Bellies were pumped and cured (curing brine contained 87.33% water, 10.00% salt, 2.00% sodium phosphate, 0.55% sodium erythorbate, and 0.12% sodium nitrite) in the Purdue University Meats Laboratory using standard practices. Bacon slabs were sliced at the 7th rib, and 1 slice from each pig was photographed and analyzed for percentage fat and lean using Adobe Photoshop 7.0 (Adobe Systems Inc., San Jose, CA). Individuals performing the sampling and analysis of bacon were blinded relative to the treatment groups of origin for the samples.
Transcript Quantification
At slaughter, a sample of liver and backfat was frozen in liquid nitrogen and stored at –80°C pending RNA isolation and analysis. Total RNA was isolated by acid guanidinium thiocyanate extraction (Chomczynski and Sacchi, 1987) and quantified from absorbance at 260 nm using a ND-1000 (NanoDrop Technologies Inc., Wilmington, DE). The RNA samples were treated with DNase I and further purified using RNeasy Mini Kit (Qiagen Inc., Thousand Oaks, CA). Samples were reverse transcribed using an Omniscript kit (Qiagen Inc.), oligo-dT (Qiagen Inc.) and random decamers (Ambion, Foster City, CA). The abundance of transcripts for FAS (EC 2.3.1.85), carnitine palmitoyl transferase Ia (CPT-Ia; EC 2.3.1.21), ACC (EC 6.4.1.2), SCD-1 (EC 1.14.19.1), and glycerol-3-phosphate dehydrogenase (GAPDH; EC 1.2.12) was determined using quantitative real-time PCR. The forward and reverse primers respectively for each transcript were as follows: FAS, AACACAGACGGTTCCAAGGAGCAA, TGTCCCATGTTCGACTTGGTGGAT; CPT-Ia, ACAAGCCTGAGTGACCATTTGCCT, TGCCATGCTCTCCTTGTTGTCAGT; SCD-I, AGCCGTCAAAGAGAAGGGTGGTTT, TGTTTACCAGCCAGGTGGCATTGA; ACC, TCTGCCTTCTGACATGCTGACGTA, TTGCTCCACTGTTGGCAGCTACAT; and GAPDH, ATCATCCCTGCTTCTACTGGTGCT, TGACAAAGTGGTCGTTGAGGGCAA. Real time PCR analysis was conducted using Brilliant SYBR Green reagent and QPCR Master Mix (Stratagene, Cedar Creek, TX) and primer concentrations that achieved the fewest amplification cycles to threshold. Serial dilutions of a reference pool of all samples from the study were used to construct standard curves. The absence of genomic DNA contamination was confirmed using a pool of all samples and an aliquot of RNA. Water was used in the no template controls containing primers, master mix, and SYBR green but lacking reverse transcriptase product. Reaction conditions were: 1 cycle at 95°C for 10 min; 40 cycles of 95°C for 30 s, 55°C for 1 min and 72°C for 30 s; and 1 cycle of 95°C for 1 min, 55°C for 30 s and 95°C for 30 s. All samples, standards, and controls were analyzed in triplicate and mean values normalized to GAPDH abundance within each sample. The appropriateness of this normalization was verified by comparing the threshold cycle among treatment groups. A difference in threshold cycle values less than 1 indicated a lack of bias for GAPDH within a treatment group.
Statistical Analysis
Data were analyzed as a completely randomized design using the MIXED procedure (SAS Inst. Inc., Cary, NC). The model accounted for effects of DDGS, CLA, and the interaction effect. Main effects for DDGS or CLA and the interactions of DDGS and CLA were compared using the LSMEANS statement. Fatty acid profiles and calculated values were analyzed for main effects of DDGS, CLA, location of fat depot, and the interactions of DDGS, CLA, and location of adipose depot. When main effects were significant (P 0.05), means were compared within factor level using the Tukey-Kramer adjustment. When DDGS effect was significant, orthogonal contrast was used to evaluate linear and quadratic effects of DDGS inclusion concentration. Data are reported as least squares means and SE. Means were considered different when P 0.05 and trends when 0.05 < P 0.1.
|
RESULTS |
|---|
|
TopAbstractINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Gilts averaged 86 ± 1.48 kg of BW at the start of the 30-d experiment and were slaughtered at a target BW of 105 ± 1.75 kg. There were no effects of DDGS, CLA, or DDGS x CLA effects on BW at slaughter, ADG, or G:F (Table 3). Likewise, there was no effect of DDGS, CLA, or DDGS x CLA on LM area, 10th- or last-rib fat depth, loin color, marbling, firmness scores, loin drip loss, belly bend measures, and hydroxyproline content (percent collagen) in belly fat (Table 4).
|
|
There were no DDGS x CLA x location of fat depot interactions for fatty acid profiles or calculated ratios; therefore, means are presented as interactions of location of adipose depot by DDGS or CLA (Tables 5 and 6, respectively). Feeding diets containing greater amounts of DDGS caused a linear decrease (P 0.05) in palmitic (16:0) and stearic (18:0) acids in all adipose tissue depots compared with controls (Table 5). Diets containing DDGS increased (P 0.05) oleic (18:1n-9), linoleic (18:2n-6), and linolenic (18:3n-3) acids in a linear manner in all 3 adipose depots. The ratio of SFA to unsaturated fatty acids linearly decreased (P 0.05) with increasing DDGS inclusion. The addition of CLA in the diet increased (P 0.05) myristic (14:0), stearic, octadecatetraenoic (18:4n-3) acids, and CLA (18:2 10t-12c) and decreased (P 0.05) oleic and vaccenic (18:1n-7) acids (Table 6).
|
|
0.05) with DDGS feeding and decreased (P 0.05) with CLA in the diet. Increasing concentrations of DDGS inclusion linearly decreased (P 0.05) and CLA inclusion increased (P 0.05) the ratio of SFA to unsaturated fatty acids. Diets containing DDGS increased (P 0.05) the ratio of n-6 to n-3 fatty acids. Bacon Analysis
Diets containing DDGS resulted in decreased (P 0.05) percent lean per slice when compared with bacon from control pigs (Table 4
). Diets containing DDGS also caused the ratio of lean muscle and fat per slice to decrease (P 0.05) from a 1:1 ratio for controls to a 2:3 ratio for the DDGS groups.
Transcript Quantification
Diets containing DDGS did not change abundance of FAS, CPT-Ia, ACC, and SCD-1 mRNA in adipose or liver samples. The addition of CLA to the diet did not alter (P > 0.05) FAS or CPT-Ia but tended to decrease (P = 0.10) ACC in adipose tissue (Table 7). There was no DDGS x CLA interaction effect (P > 0.05) for on any of the transcripts measured. Diets containing DDGS did not alter the 9 desaturase index; however, the addition of CLA to diets resulted in a significantly decreased 9 desaturase index in adipose tissue compared with control.
|
|
DISCUSSION |
|---|
|
TopAbstractINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
). The present data demonstrate a response to DDGS feeding for some variables, including IV, which is evident within 30 d. Changes in carcass fatty acid profile in response to changes in dietary lipids that accompany increased DDGS inclusion during this interval are not unexpected. Kouba et al. (2003) observed changes in fatty acid profiles of growing pigs fed high-linolenic acid diets for just 20 d. Although the minimum time to elicit a response to CLA feeding in swine has not been determined, barrows fed 0.5% CLA for 7 d had firmer bellies and altered back fat composition (Cox et al., 2004). Data from the current study confirm that the effects of CLA on adipose tissue quality and fatty acid profile are realized during a compressed feeding interval. These observations are essential for optimizing the effectiveness of CLA feeding protocols with economic considerations. It should be noted that CLA is not currently approved for use in diets fed to swine in the United States. The current data and other similar data in the literature indicate the potential beneficial effects of CLA on carcass quality.
Swine carcass lipid composition reflects the fatty acid profile of the diet (Azain, 2001) which is evident in this study. Dietary crude fat concentrations increased from 4.04 to 5.21 and 6.79% during the d 1 to 20 diets and from 3.93 to 4.44 and 6.92% during the d 21 to 30 diets when DDGS were added at 20 and 40%, respectively. Whereas the dietary fatty acid profiles are similar between the diets, this represents a relative concentration of each fatty acid. When the absolute concentration is calculated, the concentration of the fatty acid reflects this increase in dietary fat. For example, with DDGS inclusion, absolute concentrations of linoleic acid increase from 1.93% of the control diet to 2.44 and 3.20% of the 20 and 40% DDGS diets. This change in dietary fatty acid profile is reflected in the carcass-lipid profile.
Feeding CLA did not alter growth performance, and CLA inclusion in diets lacking DDGS did not alter IV. When CLA was fed with DDGS, there was a reduction in IV caused by a shift in fatty acid profile to more SFA. Feeding 0.6% CLA decreased IV in outer and inner layer backfat and belly fat when compared with diets containing no CLA (68, 65, and 66 vs. 71, 68, and 68, respectively). These data point to the potential of CLA to ameliorate the negative effects of feeding diets containing DDGS. The optimal duration of CLA feeding needs to be investigated further, particularly when diets contain greater than 20% DDGS.
Feeding diets containing DDGS linearly increased the IV in all 3 adipose depots. The increase in IV in pigs fed diets containing 40% DDGS was at least 9 points in both backfat layers (outer: 65 vs. 74, middle: 61 to 71) and 8 points in belly fat (63 vs. 71). Whereas IV is often used as an indicator of carcass lipid quality, there is not a consensus on what is an acceptable value. An IV greater than 65 may be unacceptable for some producers (Eggert et al., 2001); however, the Danish Meat Research Institute (Goodband et al., 2006) and Boyd et al. (1997) stated that IV of up to 70 or 74, respectively, are acceptable. Furthermore, these proposed standards do not specify which location of adipose tissue should be utilized as a quality indicator, and as seen in this study, IV will vary depending on the location of the adipose tissue. Therefore, depending on which IV standard and adipose sampling location is utilized as a potential quality indicator, feeding diets that include 40% DDGS may or may not result in carcasses with unacceptable lipid quality.
Diets containing DDGS decreased carcass SFA and increased unsaturated fatty acids in carcass lipid. Previous work has shown that carcass lipids containing less than 15% stearic acid and greater than 14% linoleic acid are linked to reduced carcass quality (NPPC, 2000). The concentration of stearic acid in the present work was less than 15% for all treatment groups, and pigs fed diets containing 20 or 40% DDGS had linoleic acid concentrations greater than 14%. These profiles indicate soft fat and low carcass quality when DDGS are fed at 20% of the diet or greater. These changes are reflected in the decreased ratio of SFA to unsaturated fatty acids for pigs fed diets containing 40% DDGS. Because the calculation of IV is disproportionately weighted for linoleic and linolenic acids relative to other fatty acids, the change in IV when pigs are fed 20 and 40% DDGS is primarily due to an increase in the proportion of linoleic acid.
Bacon scoring is based on lean content and slice thickness (Person et al., 2005), and feeding DDGS decreased percent lean in bacon from 49.0 to 39.7%. As a consequence there was a shift in lean:fat ratio from 0.98 to 0.67 for bacon from pigs fed 0 and 40% DDGS, respectively. Consumers prefer leaner bacon and a lean:fat ratio close to 1.0 (Person et al., 2005). Feeding DDGS reduced this ratio in a linear manner, and there was no effect of CLA in this regard.
Because adipose tissue metabolism is responsive to dietary fatty acids and aspects of lipid metabolism are controlled through changes in gene expression (Clarke and Jump, 1996), we sought to determine the impact of DDGS and CLA on expression of key genes for lipid metabolism in liver and adipose tissue. The lack of changes in abundance of mRNA for lipogenic enzymes in liver and adipose tissue samples when pigs are fed DDGS does not coincide with the changes in the carcass lipids of these pigs. Feeding CLA increased stearic acid and decreased oleic acid, suggesting a change in fatty acid metabolism at the level of adipose tissue. Previous studies indicate that CLA tends to decrease SCD-1 (Smith et al., 2002) and decreases 9 desaturase index in pigs (Demaree et al., 2002; Smith et al., 2002). Smith et al. (2002) thus concluded that although the 9 desaturase index is not a direct indicator of absolute SCD-1 enzyme activity, it is related to a change in SCD-1 enzyme activity. In the present study, though SCD-1 mRNA expression was not decreased in the adipose tissue of CLA fed pigs, the 9 desaturase index was decreased. The decrease in 9 desaturase index indicates an SCD-1 activity response to CLA feeding, which coincides with the numerical decrease in SCD-1 mRNA expression.
When data for all transcripts measured are considered, it appears that the biology underlying changes in carcass lipid characteristics with DDGS feeding are not reflected through changes in expression of these mRNA. These data also suggest that changes in carcass lipid profiles with CLA feeding do not involve changes in SCD-1 mRNA expression or that the variation among animals, the age of pigs used for these studies, or an insufficient sampling size acted to preclude detection of changes in SCD-1 mRNA. The latter is plausible because there was a numerical reduction in SCD-1 mRNA with CLA feeding that is similar to the effects observed previously in young pigs (Smith et al., 2002).
Feeding DDGS reduced carcass and bacon quality in a linear manner when fed during the final 30 d of the finishing phase. Data described here indicate that CLA, when fed for 10 d, minimizes the effects of feeding 20% DDGS, but cannot overcome the negative effects of feeding 40% DDGS on pork quality. The actions of CLA in this regard are through increased ratio of SFA to unsaturated fatty acids in carcass fat. The underlying biology of these changes is not evident; however, they do not appear to be linked to changes in mRNA expression of lipogenic enzymes.
1 Corresponding author: hmuse{at}purdue.edu
Received for publication November 16, 2007. Accepted for publication September 8, 2008.
|
LITERATURE CITED |
|---|
|
TopAbstractINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
This article has been cited by other articles:
|
|
 |
|
  K. H. Wert, H. M. White, N. R. Augspurger, J. D. Spencer, A. Schinckel, and M. A. Latour Effects of Dried Distillers Grains with Solubles and Gromega on Fat and Meat Quality from Sows Professional Animal Scientist, December 1, 2009; 25(6): 695 - 700. [Abstract] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
