J. Anim Sci.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

J. Anim Sci. 2008. 86:2063-2067. doi:10.2527/jas.2007-0791
© 2008 American Society of Animal Science
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jas.2007-0791v1
86/9/2063    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Khatib, H.
Right arrow Articles by Rutledge, J. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Khatib, H.
Right arrow Articles by Rutledge, J. J.

ANIMAL GENETICS

The fibroblast growth factor 2 gene is associated with embryonic mortality in cattle1

H. Khatib*,2, C. Maltecca*, R. L. Monson{dagger}, V. Schutzkus*, X. Wang*,{ddagger} and J. J. Rutledge{dagger}

* Department of Dairy Science, and and {dagger} Department of Animal Sciences, University of Wisconsin, Madison 53706; and {ddagger} College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi, 712100, P. R. China


   Abstract
Top
 Abstract
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
The objective of this study was to investigate the association of the fibroblast growth factor 2 (FGF2) gene with embryonic survival and fertilization rate in cattle. This gene was chosen because of its role in regulating trophectoderm expression of interferon-{tau}, the maternal pregnancy recognition factor in ruminants. To evaluate the effect of FGF2 on fertility traits, we produced in vitro-fertilized embryos from 281 Holstein cows and from 7 sires. A total of 4,542 in vitro fertilizations were performed, from which a total of 3,171 embryos were produced. Survival and fertilization rates were assessed at d 7 of embryonic development. Using the pooled DNA sequencing approach, we identified 2 SNP in FGF2, SNP11646 and SNP23. All sires and cows were genotyped for these SNP. For fertilization rate, no significant differences between genotypes were found for either SNP, whereas the effect on survival rate was significant for SNP11646. The survival rate of embryos produced from GG cows for this SNP was 37%, compared with 28 and 29% for embryos produced from AG and AA cows, respectively. Although the molecular mechanisms that cause embryonic mortality have not yet been identified, this study provides the first evidence of association between FGF2 and embryonic mortality in cattle. Thus, we propose that FGF2 can be used in animal breeding strategies to test for improved reproductive performance.

Key Words: candidate pathway • fertilization rate • FGF2 • survival rate


   INTRODUCTION
Top
 Abstract
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Reproductive performance in high-producing dairy cows is clearly suboptimal and continues to decline, as characterized by low fertilization rates and reduced embryonic survival (Moore and Thatcher, 2006Go). The decrease in fertility in dairy cattle is a worldwide problem. In the United States, the first-service conception rate has been decreasing for many years, with an estimated decline of 0.45% per year over a 20-yr period (Butler and Smith, 1989Go). Lucy (2001)Go estimated that the first-service conception rate had declined from approximately 65% in 1951 to 40% in 1996. In the United Kingdom, the conception rate is declining at approximately 1% per year, and at first-service it is currently lower than 40% (Royal et al., 2000Go). The reasons for the reduced reproductive efficiency are manifold, but it seems likely that substantial genetic effects are contributing to this infertility, despite the low heritability of most fertility traits (Veerkamp and Beerda, 2007Go). Shook (2006)Go estimated that genetics accounts for approximately one-third of the decrease in daughter pregnancy rates.

Despite the large number of quantitative trait loci studies in cattle and other species, little progress has been made on the identification of major genes affecting reproduction traits (Veerkamp and Beerda, 2007Go). In this study, we chose the fibroblast growth factor 2 (FGF2) gene to test for the association with embryonic survival and fertilization rate because of its role in regulating trophectoderm expression of interferon-{tau} (IFNT), the maternal pregnancy recognition factor in ruminants (Michael et al., 2006Go; Ocón-Grove et al., 2007Go). Bovine FGF2 has been mapped to chromosome 6, with 3 exons and a total length of more than 55 kb. In addition, it is expressed by the endometrium throughout the estrous cycle and early pregnancy (Michael et al., 2006Go).


   MATERIALS AND METHODS
Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 LITERATURE CITED
 
Animal Care and Use Committee approval was not obtained for this study because the samples were obtained from a federally inspected slaughter facility (American Foods, Green Bay, WI).

Embryo Data Collection

A total of 281 independent ovaries were collected from a total of 281 cows from a local abattoir over a period of 26 mo and used in in vitro fertilization (IVF) experiments with semen from 7 sires. On average, 12 oocytes were aspirated from each ovary. Oocytes from 191 ovaries were fertilized with semen from 1 of 3 sires (i.e., semen from a particular sire was used to fertilize all oocytes harvested from one ovary). For the remaining 90 ovaries, aspirated oocytes were divided into 2 groups; each group was fertilized with semen from 1 of 4 additional sires. A summary of the experimental design, including the number of oocytes used in the IVF for each sire, is reported in Table 1Go.


View this table:
[in this window]
[in a new window]

  		Table 1. The number of ovaries and oocytes used in in vitro fertilization with each sire, and the average number of oocytes aspirated from each cow and standard deviation
 
Oocytes were aspirated from antral follicles; processed in Tyrode’s albumin lactate pyruvate (TALP)-HEPES with 0.22 mM sodium pyruvate, 25 µg/mL of gentamicin sulfate, and 3 mg/mL of BSA; and immediately incubated for 20 to 24 h in 50-µL drops of maturation medium that had been equilibrated in 5% CO2 in air at 39°C and high humidity. On d 2, oocytes were washed 3 times in TALP-HEPES and were then placed (up to 10 oocytes each) in 44 µL of mineral oil-overlaid microdrops of IVF-TALP (Biowhittaker, Walkersburg, MD) supplemented with 0.22 mM sodium pyruvate, 25 µg/mL of gentamicin sulfate, and 6 mg/mL of EFA-free BSA.

Oocytes were fertilized with frozen-thawed Percoll-separated bull semen after being adjusted to a final concentration of 1 million sperm/mL. Each microdrop received 2.0 µg/mL of heparin to help induce capacitation; hypotaurine, penicillamine, and epinephrine were also added to maintain sperm membrane integrity and motility. After fertilization, putative zygotes were stripped of their cumulus cells by vortexing for 3 min, then washed 3 times in TALP-HEPES before being placed into 50 µL of mineral oil-overlaid microdrops of synthetic oviductal fluid (Biowhittaker) supplemented with 0.22 mM sodium pyruvate, 25 µg/mL of gentamicin sulfate, and 8 mg/mL of EFA-free BSA.

Survival and Fertilization Rates

A total of 4,542 fertilizations were performed. Survival rate of embryos was calculated as the number of viable embryos out of the number of total cultured embryos evaluated at d 7 of development (fertilization = d 0). Viability was determined as a function of the embryo’s ability to attain the morphological stage of blastocyst on d 7 of development. Embryos that failed to show cellular compaction (morula stage) on d 5 or 6 were considered nonviable. Therefore, only embryos exhibiting adequate compaction followed by the formation of a blastocoele on d 7 were considered viable. Fertilization rate was calculated as the number of embryos produced out of the total number of fertilizations. Survival and fertilization rates were assessed under the same environmental conditions to minimize biased conclusions. The environmental conditions during incubation were a temperature of 39°C, 5% CO2 in compressed air (~20% oxygen tension), and 95% relative humidity in a water-jacketed CO2 incubator.

Polymorphism Identification and Genotyping

In a previous study aimed at detecting SNP in the FGF2 gene for association with production traits in Holstein dairy cattle, 14 different sets of primers were designed for more than 6 kb of the gene, which included all exons and the 3' untranslated region (UTR; unpublished data). One SNP (A/G) was identified in intron 1 (SNP11646). In this study, we extended our SNP search to include the 5' UTR of FGF2 by using the primers FGF1-F 5' GACCTATTAGATGTGACGCC 3' and FGF1-R 5' GGACTGGCTTTGCTGAGCAG 3'. A G/T SNP was identified at position 23 (SNP23) of FGF2 (GenBank accession number NC_007304). For individual genotyping of SNP11646, primers FGF2-F 5' CATAGTTCTGTAGACTAGAAG 3' and FGF2-R 5' CCTCTAAAGAAGGATTAAGTCAAAATGGGGCTG-GTA 3' were used to amplify a 207-bp fragment. For genotyping SNP23, primers FGF1-F and FGF1-R were used to amplify a 790-bp fragment. Amplification was performed in a 25-µL reaction volume, which included 50 ng of genomic DNA, 50 ng of each primer, 200 µM each dNTP, 2.5 µL of 10x PCR buffer (Promega, Madison, WI), and 0.5 U of Taq DNA polymerase (Promega). The temperature cycles were as follows: 95°C for 5 min, followed by 32 cycles of 94°C for 45 s, touchdown annealing from 63 to 50°C for 45 s (–2°C/cycle), 72°C for 45 s, and a final extension at 72°C for 8 min. To detect variants of SNP11646 and SNP23, PCR products were digested with the restriction enzymes Csp6I and HaeII, respectively, and electrophoresed on a 2.0% agarose gel. The A and G alleles of SNP11646 were indicated by bands of 207 and 171 bp, respectively, the G allele of SNP23 was indicated by a band of 425 bp, and the T allele was indicated by bands of 285 and 140 bp.

Statistical Analysis

No evidence of linkage disequilibrium was found between SNP23 and SNP11646; therefore, they were assumed to be independent in the subsequent analysis. Ovaries from which fewer than 5 eggs were harvested were discarded and not analyzed further. Association between FGF2 polymorphisms and proportion of fertilized ova (fertilization rate) and survival of fertilized ova at d 7 (survival rate) was analyzed by using the following mixed linear model:


Formula

where yijk represents, in turn, the survival or fertilization rate of a batch of ova k from ovary i fertilized with semen from sire j; µ represents the mean for the trait considered; oi represents the random effect of the individual ovary from which ova were harvested; sj represents the random effect of sire; SNP11646ijk represents the fixed effect of the SNP11646 genotype (AA, AG, GG); SNP23ijk represents the fixed effect of the SNP23 genotype (GG, GT, TT); and {varepsilon}ijk represent the residuals, assumed to be normal and independent. An ovary effect was fitted to account for the experimental design, in which, for some ovaries, oocytes collected were fertilized by different sires. Ovaries and sires were assumed to be uncorrelated in the analysis, with variance structures [Formula and [Formula , respectively. An interaction effect between the 2 polymorphisms included in a preliminary analysis did not reach significance and was excluded from the final model. For both SNP, additivity and dominance were tested as the difference between the 2 homozygous genotypes (additive) and the difference between the heterozygous and the average of the 2 homozygous genotypes (dominance). Additive and dominance effects were calculated as the weighted difference between the 2 alternative homozygous genotypes [i.e., 1/2(GG – AA); 1/2(GG – TT)], or the difference between the heterozygous and the average of the 2 homozygous genotypes [i.e., AG – 1/2(AA + GG); GT – 1/2(GG + TT)]. All analyses were performed with the function lmer of the lme4 package of R software v. 2.5.1 (http://www.rproject.org).


   RESULTS
Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 LITERATURE CITED
 
In this study, we extended our search for SNP in the 5' UTR of FGF2 and identified a G/T SNP at position 23. To investigate the association of SNP23 and SNP11646 with fertility traits, we performed a total of 4,542 in vitro fertilizations using semen from 7 sires and ovaries from 281 cows, which produced a total of 3,171 embryos. Survival and fertilization rates were evaluated at d 7 of development.

Genotyping results of the cows revealed that the frequencies of the G and A alleles at SNP11646 were 0.53 and 0.47, respectively, whereas frequencies of the G and T alleles at SNP23 were 0.82 and 0.18, respectively. Table 2Go shows the estimated differences between genotypes of cows for SNP11646 and SNP23 for survival and fertilization rates. For fertilization rate, no significant genotypic differences were found for either SNP. On the contrary, embryonic survival showed a significant association with SNP11646. Survival rate of embryos produced from GG dams was 10.73% greater than that of embryos produced from AG dams (P = 0.005) and was 8.66% greater than that of embryos produced from AA dams (P = 0.079). The dominance test was significant for this SNP (P = 0.047), and estimates of additive and dominance genetic effects for survival rate were of 4.5% (±0.023) and 6.3% (±0.031), respectively. Least squares means and standard errors for survival and fertilization rates for the cows’ genotypes for SNP11646 and SNP23 are shown in Table 3Go. Table 4Go shows survival and fertilization rates and the total number of embryos produced from cows of each genotype for each sire. The GG genotype was associated with an increase in survival rate compared with the AG and AA genotypes. The greatest difference in survival rate among genotypes was observed for embryos produced from sire 5, with a 59% survival rate for GG cows compared with a 28% survival rate for AA cows. Sires 1, 2, 3, 4, and 6 showed genotype differences of 8 to 10% in survival rate. In contrast, for sire 7, survival rates of embryos produced from AA and GG cows were not significantly different.


View this table:
[in this window]
[in a new window]

  		Table 2. Estimated differences expressed in percentages and standard errors between dams’ genotypes for SNP11646 (GG – AG, GG – AA, AG – AA) and SNP23 (GG – GT, GG – TT, GT – TT) for survival and fertilization rates
 

View this table:
[in this window]
[in a new window]

  		Table 3. Least squares means and SE for embryo survival and fertilization rates for each cow genotype for SNP11646 (AA, AG, GG) and SNP23 (GG, GT, TT)
 

View this table:
[in this window]
[in a new window]

  		Table 4. Survival and fertilization rates (%) for each cow SNP11646 genotype (AA, AG, GG)1 and the total number of embryos and fertilizations for each sire
 

   DISCUSSION
Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
LITERATURE CITED
 
In a previous study, we used the pooled DNA sequencing approach to find polymorphisms in more than 6 kb of FGF2, including all the exons and the 3' UTR, and found only one SNP, in intron 1 (SNP11646). In the present study, we extended our search for polymorphisms and found an additional SNP in the 5' UTR: SNP23. The low frequency of SNP is likely attributable to the highly conserved nature of FGF2 sequences. In fact, the protein sequence similarity among cattle, humans, and mice is 97% (http://www.ebi.ac.uk/clustalw).

The identification of genes causing early embryonic death is a challenging task in mammalian species (VanRaden and Miller, 2006Go). Successful discovery of such genes requires both the development of an appropriate resource population and an appropriate strategy for choosing candidate genes. The present study met both of these requirements in investigating the association between FGF2 polymorphisms and survival rate and fertilization success. First, we collected ovaries from cows whose oocytes had been used to generate IVF embryos, with the aim of identifying genes affecting fertility traits in cattle. Second, FGF2 was chosen as a candidate gene affecting early embryonic survival because of its roles in embryonic development and in the signal transduction pathway of IFNT, which has a key role in the initiation and maintenance of pregnancy in ruminants (Spencer and Bazer, 2004Go). Using the same data set, we previously showed that mutations in signal transducer and activator 5A (STAT5A) are associated with embryonic survival, fertilization rate, and milk composition in Holstein dairy cattle (Khatib et al., 2008Go). It is worth noting that STAT5A is also a member of the IFNT signal transduction pathway.

Although the mechanisms that cause embryonic mortality have not yet been identified, several studies have reported the important role of FGF2 in the early stages of embryo development and initiation of pregnancy. However, this study provides the first evidence of the involvement of FGF2 in embryonic mortality in cattle. Larson et al. (1992)Go reported that the addition of the growth factors FGF2 and transforming growth factor β to cultures of IVF embryos improved the development of these embryos to blastocyst stages. Carlone and Rider (1993)Go showed that the uterine expression of FGF2 was increased by the implanting embryo in rats. Moreover, they showed that in the presence of the embryo, FGF2 was expressed by the endometrium both intra- and extracellularly, whereas in the absence of the embryo, FGF2 expression differed significantly. The authors suggested that intra- and extracellular FGF2 has a role in cellular communication between the embryo and the uterus and that the developing embryos may use the maternal growth factors for their own development (Carlone and Rider, 1993Go). More recently, Michael et al. (2006)Go reported that FGF2 is expressed in the endometrium throughout the estrous cycle and that this gene controls the expression of IFNT. Given that IFNT plays a key role in regulating the expression of genes involved in embryo implantation and in protecting the conceptus against maternal rejection (Martal et al., 1997Go), our results on the association of FGF2 with early embryonic death are in agreement with the exciting discovery of Michael et al. (2006)Go.

In previous studies, we showed that other members of the IFNT pathway—osteopontin, STAT1, and uterine milk protein—are also associated with milk production and health traits (Leonard et al. 2005Go; Cobanoglu et al., 2006Go; Khatib et al., 2007aGo,bGo). We also found that the GG genotype of FGF2 SNP11646 is associated with significant increases in milk composition and productive life in Holstein dairy cattle populations (unpublished data). In the present study, the A allele was associated with a significant decrease in embryonic survival. Thus, our findings on the involvement of STAT5A and FGF2 in both milk production and fertility traits imply that the IFNT pathway could be an excellent candidate pathway to search for other genes that tie milk production and health traits of cows with pregnancy success and embryonic survival at the molecular level. Such genes can be used in gene-assisted selection programs to improve production and reproduction performance in cattle.


   Footnotes
 
1 This study was supported by USDA Hatch grant No. WIS-04895 from the University of Wisconsin-Madison. Back

2 Corresponding author: hkhatib{at}wisc.edu

Received for publication December 11, 2007. Accepted for publication May 1, 2008.


   LITERATURE CITED
Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 


Butler, W. R., and R. D. Smith. 1989. Interrelationships between energy balance and postpartum reproductive function in dairy cattle. J. Dairy Sci. 72:767–783.[Abstract/Free Full Text]

Carlone, D. L., and V. Rider. 1993. Embryonic modulation of basic fibroblast growth factor in the rat uterus. Biol. Reprod. 49:653–665.[Abstract]

Cobanoglu, O., I. Zaitoun, Y. M. Chang, G. E. Shook, and H. Khatib. 2006. Effects of the signal transducer and activator of transcription 1 (STAT1) gene on milk production traits in Holstein dairy cattle. J. Dairy Sci. 89:4433–4437.[Abstract/Free Full Text]

Khatib, H., R. L. Monson, V. Schutzkus, D. M. Kohl, G. J. M. Rosa, and J. J. Rutledge. 2008. Mutations in the STAT5A gene are associated with embryonic survival and milk composition in cattle. J. Dairy Sci. 91:784–793.[Abstract/Free Full Text]

Khatib, H., V. Schutzkus, Y. M. Chang, and G. J. M. Rosa. 2007a. Pattern of expression of the uterine milk protein gene and its association with productive life in dairy cattle. J. Dairy Sci. 90:2427–2433.[Abstract/Free Full Text]

Khatib, H., I. Zaitoun, J. Wiebelhaus-Finger, Y. M. Chang, and G. J. M. Rosa. 2007b. The association of bovine PPARGC1A and OPN genes with milk composition in two independent Holstein cattle populations. J. Dairy Sci. 90:2966–2970.[Abstract/Free Full Text]

Larson, R. C., G. G. Ignotz, and W. B. Currie. 1992. Transforming growth factor beta and basic fibroblast growth factor synergistically promote early bovine embryo development during the fourth cell cycle. Mol. Reprod. Dev. 33:432–435.[CrossRef][Medline]

Leonard, S., H. Khatib, V. Schutzkus, Y. M. Chang, and C. Maltecca. 2005. Effects of the osteopontin gene variants on milk production traits in dairy cattle. J. Dairy Sci. 88:4083–4086.[Abstract/Free Full Text]

Lucy, M. C. 2001. Reproductive loss in high-producing dairy cattle: Where will it end? J. Dairy Sci. 84:1277–1293.[Abstract]

Martal, J., N. Chêne, S. Camous, L. Huynh, F. Lantier, P. Hermier, R. L’Haridon, G. Charpigny, M. Charlier, and G. Chaouat. 1997. Recent developments and potentialities for reducing embryo mortality in ruminants: The role of IFN-tau and other cytokines in early pregnancy. Reprod. Fertil. Dev. 9:355–380.[CrossRef][Medline]

Michael, D. D., I. M. Alvarex, O. M. Ocón, A. M. Powell, N. C. Talbot, S. E. Johnson, and A. D. Ealy. 2006. Fibroblast growth factor-2 is expressed by the bovine uterus and stimulates interferon-tau production in bovine trophectoderm. Endocrinology 147:3571–3579.[Abstract/Free Full Text]

Moore, K., and W. W. Thatcher. 2006. Major advances associated with reproduction in dairy cattle. J. Dairy Sci. 89:1254–1266.[Abstract/Free Full Text]

Ocón-Grove, O. M., F. N. Cooke, I. M. Alvarez, S. E. Johnson, T. L. Ott, and A. D. Ealy. 2007. Ovine endometrial expression of fibroblast growth factor (FGF) 2 and conceptus expression of FGF receptors during early pregnancy. Domest. Anim. Endocrinol. 34:135–145.[CrossRef][Medline]

Royal, M., G. E. Mann, and A. P. Flint. 2000. Strategies for reversing the trend towards subfertility in dairy cattle. Vet. J. 160:53–60.[CrossRef][Medline]

Shook, G. E. 2006. Major advances in determining appropriate selection goals. J. Dairy Sci. 89:1349–1361.[Abstract/Free Full Text]

Spencer, T. E., and F. W. Bazer. 2004. Conceptus signals for establishment and maintenance of pregnancy. Reprod. Biol. Endocrinol. 2:49.[CrossRef][Medline]

VanRaden, P. M., and R. H. Miller. 2006. Effects of nonadditive genetic interactions, inbreeding, and recessive defects on embryo and fetal loss by seventy days. J. Dairy Sci. 89:2716–2721.[Abstract/Free Full Text]

Veerkamp, R. F., and B. Beerda. 2007. Genetics and genomics to improve fertility in high producing dairy cows. Theriogenology 68S:S266–S273.[CrossRef][Medline]


This article has been cited by other articles:


Home page
 J DAIRY SCIHome page
A. M. Driver, W. Huang, S. Gajic, R. L. Monson, G. J. M. Rosa, and H. Khatib
Short communication: Effects of the progesterone receptor variants on fertility traits in cattle
J Dairy Sci, August 1, 2009; 92(8): 4082 - 4085.
[Abstract] [Full Text] [PDF]

Home page
 J DAIRY SCIHome page
H. Khatib, W. Huang, X. Wang, A. H. Tran, A. B. Bindrim, V. Schutzkus, R. L. Monson, and B. S. Yandell
Single gene and gene interaction effects on fertilization and embryonic survival rates in cattle
J Dairy Sci, May 1, 2009; 92(5): 2238 - 2247.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jas.2007-0791v1
86/9/2063    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Khatib, H.
Right arrow Articles by Rutledge, J. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Khatib, H.
Right arrow Articles by Rutledge, J. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS