J. Anim Sci.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

J. Anim Sci. 2008. 86:1789-1798. doi:10.2527/jas.2007-0801
© 2008 American Society of Animal Science
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jas.2007-0801v1
86/8/1789    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by White, H. M.
Right arrow Articles by Latour, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by White, H. M.
Right arrow Articles by Latour, M. A.

ANIMAL GROWTH, PHYSIOLOGY, AND REPRODUCTION

Effects of temperature stress on growth performance and bacon quality in grow-finish pigs housed at two densities

H. M. White, B. T. Richert, A. P. Schinckel, J. R. Burgess, S. S. Donkin and M. A. Latour1

Department of Animal Sciences, Purdue University, West Lafayette, IN 47907


   Abstract
Top
 Abstract
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Managing stressors is essential for optimizing pig growth performance. To determine the effects of temperature and space allocation on growth performance and carcass characteristics, pigs were housed within their thermoneutral zone, at 23.9°C, or above their thermoneutral zone, at 32.2°C, and were provided either 0.66 or 0.93 m2/pig for the final 35 d of the grow-finish period. Individual BW were recorded on d 1, 10, 20, and 30. At slaughter, carcass measurements and samples of backfat and belly fat were collected. Final BW was decreased (P ≤ 0.05) from 113 to 103 kg for pigs housed at 32.2°C. The ADG was reduced (P < 0.05) for pigs housed at 32.2°C (0.89 vs. 0.54 kg/d), as was G:F (0.28 vs. 0.24). Housing at 0.66 m2/pig resulted in pigs that were lighter (P ≤ 0.05), at 106 compared with 110 kg, as a result of decreased (P ≤ 0.05) ADG (0.78 to 0.65 kg/d) and decreased (P ≤ 0.05) G:F (0.275 to 0.255) compared with pigs housed at 0.93 m2/pig. Pigs housed at a greater spatial allocation had elevated (P ≤ 0.05) ADFI. The interaction of housing at 32.2°C and decreasing spatial allocation increased (P ≤ 0.05) the adipose iodine value from 66.8 to 70.4, decreased (P ≤ 0.05) the saturated:unsaturated fatty acids ratio from 0.59 to 0.56, and increased (P ≤ 0.05) the n-6:n-3 from 23.56 to 25.27. Decreased spatial allocation resulted in decreased (P ≤ 0.05) belly weights. Although increased temperature did not affect belly weight, the 32.2°C pigs had decreased (P ≤ 0.05) raw and cooked slice weights, increased (P ≤ 0.05) percentage lean of bacon, increased (P ≤ 0.05) lean:fat ratio of bacon slices, increased (P ≤ 0.05) raw slice scores, and increased (P ≤ 0.05) quantity of collagen in belly fat. Some of these changes may have resulted from changes in lipid metabolism. Increasing spatial allocation in the 32.2°C pigs decreased fatty acid synthase (P = 0.03) and stearoyl-CoA desaturase- 1 (P = 0.08) mRNA expression in adipose tissue. The results from this study demonstrated decreased growth, carcass lipid quality, and bacon quality in pigs housed at temperatures above the thermoneutral zone; however, increasing the spacial allocation for housing may be a means to ameliorate the negative effects of temperature stress.

Key Words: bacon quality • carcass quality • housing density • swine • temperature stress


   INTRODUCTION
Top
 Abstract
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Prolonged elevated temperatures negatively affect growth of livestock. The optimum temperature range for finishing pigs is between 10 and 23.9°C (Myer and Bucklin, 2001Go), and temperatures above 23.9°C decrease voluntary feed intake and pig growth (Kouba et al., 2001Go). Changes in growth performance with heat stress appear to be related to reduced feed intake rather than changes in nutrient metabolism.

Other stressors such as space allocation also reduce growth performance. Gonyou and Stricklin (1998)Go examined the effects of floor space allowance on productivity in grow-finish swine. Housing densities less than 0.76 m2/pig reduce ADG and ADFI (Gonyou and Stricklin, 1998Go). Heat stress may augment the negative effect of spatial stress on growth performance. Kerr et al. (2005)Go examined the effects of 1 or 2 m2/pig and environmental temperatures of 22 or 30°C on growth of male pigs averaging 34.5 kg. Stocking density resulted in no change in growth performance; however, when pigs were challenged with high temperatures and high density, there was a stocking density x temperature interaction on feed intake (Kerr et al., 2005Go).

We hypothesized that temperatures above the thermal neutral zone for pigs would decrease feed intake, BW gain, and carcass quality, whereas increasing spatial allocation would ameliorate some of these changes. The objectives of this experiment were to determine the effects of housing temperature at 23.9 or 32.2°C and spatial allocation of either 0.66 or 0.93 m2/pig, and any interaction effects, on growth performance and carcass lipid firmness in grow-finish gilts. In addition, we investigated the accompanying changes in the mRNA expression for key lipogenic enzymes.


   MATERIALS AND METHODS
Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 LITERATURE CITED
 
The Purdue Animal Care and Use Committee approved animal housing, handling, and sample collection procedures.

Animal Handling and Diets

Nonpregnant gilts (n = 240) were selected from an industry source (Rose Hill, NC). Pigs were 88 ± 0.4 kg of BW at the beginning of the experiment and were housed at LFM Quality Laboratories Inc. (Terre Haute, IN). Pigs were randomly assigned to a housing temperature either within the thermal neutral zone (i.e., 23.9°C) or above the thermal neutral zone (i.e., 32.2°C) for grow-finish pigs. Humidity was not controlled during the experiment and was different between treatments. Heating systems maintained the target temperatures for a 12-h period during the day. During the night, heating was terminated, and the rooms were allowed to equilibrate to ambient temperature. High and low temperatures and humidity were recorded at the beginning and end of each 12-h period throughout the experiment. Ventilation systems consisted of 3 pit fans that were run continuously in addition to 6 sidewall fans that provided cooling at windspeed. To maintain 32.2°C, sidewall fans were locked for minimum air entrance, and air was instead drawn in through 2 end gable inlets that supplied preheated attic air.

Pigs were housed at a density of 5 or 7 pigs per pen at a constant pen size of 4.64 m2. Seventy of the pigs within each temperature group were housed at 0.93 m2/pig, and the remaining pigs were housed at 0.66 m2/pig within 10 pens per treatment group. Pigs were given ad libitum access to corn-soybean meal-based diets (Tables 1Go and 2Go) formulated to meet or exceed the NRC requirements for swine (NRC, 1998Go). Individual BW were recorded on d 1, 10, 20, and 30. Feed was added to pen feeders daily and recorded. At the conclusion of the study, feed remaining in the feeder was weighed, and total feed intake for each pen was calculated by difference for the duration of the study.


View this table:
[in this window]
[in a new window]

  		Table 1. Diets fed to pigs housed at 23.9 or 32.2°C and either 0.66 or 0.93 m2/pig
 

View this table:
[in this window]
[in a new window]

  		Table 2. Fatty acid profile, iodine value (IV), and saturated:unsaturated (SAT:UNSAT) and n-6: n-3 ratios of diets fed to grow-finish pigs
 
Pigs in one-half of the pens within each treatment were slaughtered on d 28 relative to the beginning of the experiment, and the rest were slaughtered on d 35. The target final BW was 108 kg as an average across all groups. Treatment groups were balanced within slaughter day. Carcass measurements taken 24 h after exsanguination included the following: 1st-, 10th-, and last-rib backfat depth, loin eye area, and loin color, marbling, and firmness scores (NPB, 2000Go).

Analysis of Fatty Acid Profile

Fatty acid analysis was determined separately for belly fat, outer layer backfat, and middle layer backfat. A 200-mg sample of each fat depot was minced, combined with 2 mL of hexane, vortexed for 1 min, and heated in an 80°C water bath for 30 min. A volume of 0.1 mL of 2 N methanolic KOH was added, and the samples were vortexed for 2 min and centrifuged at 1,850 x g for 20 min. A 50-µL aliquot of the top layer was diluted with 0.95 mL of hexane. Fatty acid profile was determined by GLC with a Varian 3900 gas-liquid chromatograph equipped with an 8400 autosampler and WCOT fused silica 30 m x 0.32 mm CP wax 52 CP capillary column (Varian Inc., Palo Alto, CA) using helium as the carrier gas. A volume of 5 µL of sample was injected into the chamber and mixed with helium at a 1:100 dilution rate at 240°C.

Iodine value (Madsen et al., 1992Go) was calculated as described previously (AOAC, 1990Go). The n-6:n-3 ratios were calculated as described previously by Gordon et al. (2005)Go. The {Delta}9-desaturase index, an estimator of stearoyl-CoA desaturase-1 (SCD-1) activity, was calculated as described by Smith et al. (2002)Go.

Bacon Analysis

Bellies were pumped and cured at an industry production facility using standard bacon preparation procedures (Smithfield Foods, Smithfield, VA). Handling of bellies was performed without knowledge of the treatment groups by the operators. Bacon slabs were sliced, and every third slice (3 slices total per pig) was collected and photographed. The entire bacon surface area and the lean sections were traced, and the areas were recorded (Adobe Photoshop, Adobe Systems Inc., San Jose, CA). Fat sections were determined as a percentage of total area, and percentage lean and lean:fat ratios were calculated. Bacon slices were classified as 1, 2, or 3, as described by Person et al. (2005)Go. Slices with a thickness greater than or equal to 1.9 cm at all points and greater than 50% lean were classified as grade 1 slices. If the bacon slice was less than 1.9-cm thick at any point or less than 50% lean, it was a grade 2 slice. Furthermore, the slices that could not be categorized as a grade 2 slice or came from the ends were classified as ends and pieces or grade 3 slices. Slices were individually weighed, and their length was measured before and after cooking in a conventional oven for 10 min (5 min per side) at 204°C. Hydroxyproline content of belly fat was measured according to the methods of Woessner (1961)Go. Collagen content was calculated assuming 12.5% hydroxyproline content of the collagen (Woessner, 1961Go).

Transcript Quantification

At slaughter, samples of liver and backfat were placed in Trizol reagent (Invitrogen, Carlsbad, CA) and stored at -80°C pending RNA isolation and analysis. Total RNA was isolated by acid guanidinium thiocyanate extraction (Chomczynski and Sacchi, 1987Go) and quantified from absorbance at 260 nm using a ND-1000 (NanoDrop Technologies Inc., Wilmington, DE). The RNA samples were treated with DNase I and were further purified using RNeasy Mini Kit (Qiagen Inc., Thousand Oaks, CA). Samples were reverse-transcribed using an Omniscript kit (Qiagen Inc.), oligo-dT (Qiagen Inc.), and random decamers (Ambion, Foster City, CA). The abundance of fatty acid synthase (FAS; EC 2.3.1.85), carnitine palmitoyl transferase Ia (EC 2.3.1.21), SCD- 1 (EC 1.14.19.1), and glycerol-3-phosphate dehydrogenase (GAPDH; EC 1.2.12) mRNA were determined using quantitative real-time PCR. Forward and reverse primers (5' to 3'), respectively, for each transcript were as follows: FAS, AACACAGACGGTTCCAAGGAGCAA and TGTCCCATGTTCGACTTGGTGGAT; carnitine palmitoyl transferase Ia, ACAAGCCTGAGTGACCATTTGCCT and TGCCATGCTCTCCTTGTTGTCAGT; SCD-1, AGCCGTCAAAGAGAAGGGTGGTTT and TGTTTACCAGCCAGGTGGCATTGA; and GAPDH, ATCATCCCTGCTTCTACTGGTGCT and TGACAAAGTGGTCGTTGAGGGCAA.

The PCR reactions were conducted using Brilliant SYBR Green reagent and QPCR Master Mix (Stratagene, Cedar Creek, TX) using primer concentrations that achieved the fewest amplification cycles to the threshold point. Pooled samples were used for the standard curves, and all samples were analyzed in triplicate. A pooled sample of RNA was used as a no-reverse transcriptase control, and water served as the no-template control. Reactions were run in 3 segments: 1 cycle at 95°C for 10 min; 40 cycles of 95°C for 30 s, 55°C for 1 min, and 72°C for 30 s; and 1 cycle of 95°C for 1 min, 55°C for 30 s, and 95°C for 30 s. Only assays with efficiencies between 90 and 110% were analyzed. All samples, standards, and controls were analyzed in triplicate, and mean values were normalized to the GAPDH abundance within each sample. The appropriateness of this normalization was verified by comparing the threshold cycle across treatment groups. A difference in threshold cycle values less than 1.0 indicated a lack of bias for GAPDH within a treatment group.

Statistical Analysis

Data were analyzed as a completely randomized design using the MIXED procedure (SAS Inst. Inc., Cary, NC). The model accounted for the effects of temperature, spatial allocation, and their interaction. There were no effects of kill day or humidity, so they were excluded from the analysis. The statistical unit was the pen; growth and feed intake data were collected and analyzed for every animal, and 2 replicates from each pen were analyzed for carcass and bacon characteristics. A subsample of 8 pigs per treatment was analyzed for mRNA expression.

Main effects were evaluated using the LSMEANS statement. When the effects of temperature or spatial allocation were significant (P ≤ 0.05), means were compared using the Tukey-Kramer adjustment. Chilled carcass weight and fat depth measurements were analyzed using HCW as a covariate. Data are reported as least squares means plus or minus standard error. Means were considered different when P ≤ 0.05 and tended to differ when 0.05 < P ≤ 0.10.


   RESULTS
Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 LITERATURE CITED
 
Temperature and Kill Day Measurements

Mean high and low temperatures were 22.4°C ± 0.1 and 20.6°C ± 0.5 for the 23.9°C group and 32.2°C ± 0.1 and 29.07°C ± 0.53 for the 32.2°C group (Table 3Go; Figure 1Go). Mean humidity was 44.3% and 69.2% ± 1.1 for 23.9°C and 32.2°C groups, respectively. Live BW on day of slaughter were 107 ± 1.0 and 110 ± 1.0 kg for pigs killed on d 28 and 35, respectively.


View this table:
[in this window]
[in a new window]

  		Table 3. Humidity, and high and low temperatures for the 35-d study of pigs housed at target temperatures of either 23.9 or 32.2°C1,2
 

Figure 1
View larger version (26K):
[in this window]
[in a new window]

  		Figure 1. Humidity and high and low temperatures for the 35-d study of pigs housed at target temperatures of either 23.9 or 32.2°C. Actual temperatures were recorded at the beginning and end of each 12-h period; humidity was not regulated.

 
Growth and Carcass Measurements

Temperature above 23.9°C and spatial allocation of 0.66 m2/pig independently reduced (P ≤ 0.05) final BW, ADG, and ADFI and increased (P ≤ 0.05) G:F (Table 4Go). The ADG was calculated for the first and second halves of the study; however, because rate of gain was not different within treatment groups between the 2 periods, ADG is reported for the entire experiment. Pigs housed at 32.2°C had 9.8% less final BW, 39.3% less ADG, 32.3% less ADFI, and a 16.3% less G:F compared with pigs housed at 23.9°C. Reducing spatial allocation from 0.93 to 0.66 m2/pig resulted in 4.0% less final BW, 17.0% less ADG, 10.7% less ADFI, and a 7.8% less G:F ratio. There was a temperature and spatial allocation interaction effect (P ≤ 0.05) on ADFI and G:F ratio.


View this table:
[in this window]
[in a new window]

  		Table 4. Effects of temperature and spatial allocation on final BW, ADG, ADFI, and G:F1
 
Temperature or spatial allocation did not alter (P ≥ 0.10) cold carcass weight; carcass length; fat depth at 1st, 10th, and last ribs; loin depth; or loin area relative to HCW. Mean measurements for carcass fat depths were 1st rib: 2.9 ± 0.1 cm; 10th rib: 1.4 ± 0.0 cm; last rib: 1.9 ± 0.1 cm; last lumbar: 1.3 ± 0.0 cm; loin depth: 6.3 ± 0.0 cm; and loin area: 17.1 ± 0.1 cm2. Increasing spatial allocation to 0.93 m2/pig decreased (P ≤ 0.05) belly weights, whereas temperatures above 23.9°C tended to decrease (P = 0.09) belly weight (Table 5Go).


View this table:
[in this window]
[in a new window]

  		Table 5. Effects of temperature and spatial allocation on lean content and cooking characteristics of bacon slices1
 
Fatty Acid Analysis

There were no interactions of temperature, spatial allocation, and location of fat depot (outer layer backfat, inner layer backfat, or belly fat) for fatty acid profiles or calculated ratios; therefore, layers were averaged for statistical tables. Eicosanoic acid (20:0) was decreased (P ≤ 0.05) and palmitic acid (16:0) tended to be decreased (P = 0.07) in adipose tissue from animals housed at 32.2°C compared with animals housed at normal temperatures (Table 6Go). Housing at 32.2°C decreased (P ≤ 0.05) oleic (18:1n-9), increased (P ≤ 0.05) linoleic (18:2n-6), and increased (P ≤ 0.05) linolenic (18:3n-3) acid levels, and iodine values were increased (P ≤ 0.05) by 2.3%.


View this table:
[in this window]
[in a new window]

  		Table 6. Effect of temperature and spatial allocation on fatty acid profiles, iodine values (IV), saturated:unsaturated (SAT:UNSAT), and n-6:n-3 of back and belly fat from grow-finish pigs1
 
Decreased spatial allocation increased (P ≤ 0.05) the level of linoleic (18:2n-6) and linolenic (18:3n-4, 18:3n-3) acid, increased (P ≤ 0.05) iodine value, and tended to decrease (P = 0.10) arachidonic (20:4n-6) acid.

There was an interaction (P ≤ 0.05) of temperature and spatial allocation on eicosanoic (20:0), arachidonic (20:4n-6), and a tendency for an effect (P ≤ 0.10) on lignoceric (24:0) acid. Space allocation had no effect on eicosanoic (20:0) acid in adipose of pigs housed at 23.9°C but was elevated as space allocation was increased for pigs housed at 32.2°C. Elevated temperatures had no effect on arachidonic (20:4n-6) or lignoceric (24:0) acids in adipose at 23.9°C but tended (P = 0.10; P = 0.06, respectively) to be elevated as special allocation was increased for 32.2°C pigs. The interaction of temperature and spatial allocation tended to increase (P = 0.08) palmitic (16:0) and tended to increase (P = 0.09) stearic (18:0) acids. Elevated temperatures tended (P = 0.07) to decrease palmitic acid when spatial allocation was increased in the 32.2°C group. Stearic acid was increased when spatial allocation was increased in the 32.2°C group.

Decreased spatial allocation did not alter iodine value in the 23.9°C group but increased (P ≤ 0.05) iodine value in the 32.2°C group. Decreased spatial allocation in the 23.9°C group decreased (P ≤ 0.05) the ratio of saturated to unsaturated fatty acids. Increasing spatial allocation decreased (P ≤ 0.05) the ratio of n-6 to n3 fatty acids in the 32.2°C pigs.

Bacon Analysis and Collagen Content

Pigs in the 32.2°C group yielded bacon with decreased (P ≤ 0.05) raw and cooked slice weights, increased (P ≤ 0.05) percentage lean in bacon, increased (P ≤ 0.05) lean:fat ratio in the bacon, and elevated (P ≤ 0.05) raw slice score (Table 5Go). The 32.2°C pigs had greater (P ≤ 0.05) content of collagen in belly fat than control-housed pigs (1.18 and 1.02 g/100 g of fat tissue, respectively). Spatial allocation had no effect on the level of collagen in bacon.

Transcript Quantification

Temperature stress, spatial allocation, and the interaction of temperature on spatial allocation did not alter mRNA abundance for lipogenic enzymes in liver. There was an interaction (P ≤ 0.05) between housing temperature and spatial allocation of FAS mRNA that was characterized by a tendency (P = 0.09) for increased spatial allocation to decrease FAS expression in adipose tissue from 32.2°C-housed pigs (Table 7Go). Likewise, there was a tendency (P = 0.08) for a spatial allocation x temperature interaction on SCD-1, in which expression was decreased with increased spatial allocation, but only for 32.2°C pigs.


View this table:
[in this window]
[in a new window]

  		Table 7. Effect of temperature and spatial allocation on liver and adipose tissue mRNA abundance of fatty acid synthase (FAS), carnitine palmitoyl transferase I (CPT-Ia), and stearoyl-CoA desaturase (SCD-1) normalized to glycerol-3-phosphate dehydrogenase1
 

   DISCUSSION
Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
LITERATURE CITED
 
Carcass quality is a reflection of several different factors including carcass weight, fat deposited, fat firmness, and weight of primal cuts. The ham, loin, and belly comprise the top 75% of the carcass monetary value; therefore, the quality of these components is economically important (Marcous et al., 2007Go). The increasing demand for bacon since the 1990s has further increased the value of the fresh belly. The contribution of the belly to the overall market carcass value has continued to increase steadily from 1999 to 2003 (Marcous et al., 2007Go). In 1992, the Pork Chain Quality Audit stated that of all bellies produced, 2% of bellies lacked the firmness required for bacon production, whereas 10% were too thin (Cannon et al., 1996Go). Thin bellies alone represent a $97 million dollar loss to packers (Stetzer and McKeith, 2003Go) that could be reclaimed if fresh belly quality is improved.

To examine the effects of increased environmental temperature on carcass and bacon quality, pigs were housed either within or above their thermoneutral zone of 10 to 23.9°C (Myer and Bucklin, 2001Go). Though temperatures fluctuated over a 24-h day-night cycle as presented earlier, the actual temperatures of the 32.2°C pigs were maintained above the thermoneutral zone during the entire 35 d. This constant elevated temperature represents a chronic period of temperature stress. Lopez et al. (1991)Go showed similar temperature fluctuations in their heat stress treatment group over a 21-d period and demonstrated significantly increased respiratory rates in the heat-stressed pigs.

Pigs housed at 32.2 compared with 23.9°C had reduced ADG and ADFI, reduced G:F ratios, and altered carcass quality. Providing more pen space per pig resulted in increased ADG and ADFI in both the 23.9 and 32.2°C environments. These data are in agreement with previous observations that housing temperatures above optimum levels for growing pigs decrease feed intake and growth rate (Verstegen et al., 1973Go; Myer and Bucklin, 2001Go). For finishing pigs weighing between 54.5 and 118.2 kg, the optimum temperature identified is 18.3°C, and the desirable temperature range is between 10 and 23.9°C (Myer and Bucklin, 2001Go). Temperatures above this range decrease daily feed intake, reduce meal size, and decrease meal frequency (Nienaber et al., 1999Go). The voluntary decrease in feed intake at environmental temperatures above 23.9°C is a response in the pig to reduce the thermic load associated with feed intake and an attempt to maintain core body temperature (Collin et al., 2001Go).

The data from the present study indicate that pigs maintained at 32.2°C consumed 1 kg of feed less per day than pigs housed at 23.9°C temperatures. The decrease in ADFI for the 32.2°C pigs is 100 g/degree over 23.9°C for the data reported and is greater than the previously reported estimate of 55 g/degree above thermoneutrality (Le Bellego et al., 2002Go). The previous study examined barrows from 27 to 100 kg housed at 22 or 29°C, and the ADFI reduction estimate was calculated for the entire period (Le Bellego et al., 2002Go). Covering such varied stages of growth may account for the differences in ADFI between the 2 studies. Other sources of differences could have been feeder size and style, floor space per pig, ventilation, and flooring; however, because these details are not available, the exact reason(s) for the differences between the previous study and this study are not apparent.

In the present study, ADG and ADFI were significantly reduced and G:F was significantly decreased when spatial allocation was decreased from 0.93 to 0.66 m2. Previous data indicate decreased feed intake and ADG with increasing housing density (Kornegay et al., 1993Go; Brumm and Miller, 1996Go; Wolter et al., 2002Go, 2003Go). Stocking densities of 0.650 and 0.325 m2/pig resulted in similar final BW at less ADG and increased time to slaughter in wean to finish (Wolter et al., 2002Go) and grow-finish pigs (Brumm and Miller, 1996Go), respectively. For pigs housed at 23.9°C, a 28.5% reduction in spatial allocation resulted in an 11.6% decrease in ADG, which is twice the decrease reported by Brumm and Miller (1996)Go. A 28% reduction in spatial allocation resulted in a 4.3% decrease in ADG with a consistent lack of changes in G:F (Brumm and Miller, 1996Go). Though the spatial allocations used in both studies represented a 28% reduction in space per pig, the spatial allocation used relative to the minimum spatial allocation for maximum growth performance (NCR-98, 1993; Gonyou and Stricklin, 1998Go) may be the source of the differences between data presented here and previously published information. Both spatial allocations (Brumm and Miller, 1996Go) were below the minimum requirements for work reported previously, which may explain the lessened response compared with the current study.

Pigs challenged with both increased temperature and decreased spatial allocation had the lowest final BW, ADG, and ADFI. The percentage difference in final BW, ADG, and ADFI for 32.2°C pigs housed at 0.93 m2 compared with 23.9°C housed pigs at the same density were 7.8, 26.3, and 27.6% lower, respectively; however, the percentage decreases for 32.2°C pigs housed at 0.66 m2 compared with 23.9°C pigs housed at 0.93 m2 were 16.6, 52.3, and 37.9%, respectively. These data demonstrate both independent effects of temperature and spatial allocation as well as a synergistic effect when the 2 stressors are combined, resulting in an amplified response as seen in growth performance.

Physiological response to stressors, such as heat and spacial restriction, results in activation of the sympathetic nervous system and release of catecholamines and glucocorticoids (Breinekova et al., 2006Go). Cortisol regulates growth, immunity, and intermediary metabolism including gluconeogenesis, glycogen synthesis, and lipogenesis (Semenkovich, 1997Go; Chrousos, 2007Go). The regulation of these processes by stress-activated hormones is one source of altered metabolism during periods of stress that may contribute to changes in feed intake, BW gain, and carcass quality. The negative effects of the 2 stressors are additive and when present simultaneously, result in a dramatic decrease in growth performance. Although not measured directly, these hormonal changes likely play a role in the responses to heat and spatial allocation observed in this experiment. Additional responses to reduced space allocation in pigs housed under 32.2°C conditions suggest that neither of the stressors, when applied individually in this experiment, were sufficient to maximally activate this response.

Carcass quality changes are reflected in altered fatty acid profiles and bacon characteristics. Decreased spatial allocation and 32.2°C independently increased iodine value with the combination of the 2 stressors synergizing to increase iodine value to 72.5, 4.3 points greater than the control iodine values. Furthermore, in the 32.2°C pigs, when spatial allocation was decreased, the saturated:unsaturated fatty acid ratio decreased. Increased iodine value (Madsen et al., 1992Go) and decreased saturated to unsaturated fatty acid ratios (Azain, 2001Go) indicate a decrease in carcass quality due to decreased fat firmness. High levels of unsaturated fatty acids result in rapid oxidation, which decreases shelf life (Wood et al., 2003Go). Furthermore, high levels of unsaturated fatty acids in diets produce bacon that is smeary, separates, and causes processing difficulties (Pearson et al., 2005). Many processors utilize iodine value as a numerical evaluation of carcass quality and thus have goal iodine values. Although acceptable iodine value thresholds may vary between processors, an iodine value greater than 65 may be unacceptably high (Eggert et al., 2001Go).

The pigs housed at 32.2°C had increased levels of collagen in bacon relative to control pigs. Lower content of collagen per unit of fat indicates larger adipocytes (Woessner, 1961Go). Adipocytes fill with triacylglycerides (TAG) until a maximum point is reached, which triggers proliferation (Smith et al., 2006Go). Increased adiposity can be described as net fatty acid accumulation in adipocytes and is measured as a daily change in total mass of fatty acids in adipose tissue (Smith et al., 2006Go). In finishing swine, the net deposition of fatty acids as TAG in adipocytes is between 250 to 450 g/d (Azain, 2001Go). As adipocyte size increases, the rate of TAG synthesis increases; although fatty acids are also released by lipolysis, the relative rates of these processes favor TAG accumulation (Smith et al., 2006Go).

Increased collagen per gram of adipose tissue for the 32.2°C pigs indicates fewer adipocytes per gram of adipose tissue, perhaps due to decreased rate of adipocyte filling, proliferation, or both as a consequence of elevated temperatures. Increased FAS mRNA in adipose tissue with reduced space allocation agrees with previous information that fatty acid synthesis is upregulated with stress and cortisol concentrations (Chrousos, 2007Go). The changes in lipogenic enzyme expression in adipose tissue may reflect the actions of stressors to alter growth and carcass quality through hormone concentrations, nutrients, or both. Increases in glucocorticoids are 1 component of stress-induced BW gain, an active area of research within the area of human obesity (Kyrou et al., 2006Go). Stress stimulates the release of glucocorticoids that act to upregulate expression and stabilize mRNA of lipogenic enzymes, such as FAS and lipoprotein lipases, resulting in increased rates of de novo lipogenesis (Semenkovich, 1997Go; Kyrou et al., 2006Go).

Decreased SCD-1 mRNA expression in adipose tissue was seen in the present study in pigs housed at greater spatial allocation (0.93 m2), whereas the pigs housed at high temperature and high density tended to have increased adipose concentrations of SCD-1. Decreased SCD-1 content in adipose tissue has also been reported in pigs housed at 31°C compared with those housed at 20°C (Kouba et al., 1999Go). The change in SCD-1 expression in the 32.2°C pigs is consistent with the changes in the saturated:unsaturated fatty acid ratios. As the level of SCD-1 expression increased in the low spatial allocation group within the 32.2°C-housed pigs, the ratio of saturated to unsaturated fatty acids decreased. Because SCD-1 catalyzes the conversion of dietary or de novo saturated fatty acids into monounsaturated fatty acids in the endoplasmic reticulum (Nakamura and Nara, 2004Go; Dobrzyn and Ntambi, 2005Go), it increases the desaturation level of adipose depots. When SCD-1 expression is increased, more saturated fatty acids will be desaturated, thus altering the ratio of saturated to unsaturated fatty acids in favor of unsaturation.

When pigs were challenged with increased temperature and decreased spatial allocation, the level of saturation was decreased; however, increasing the spatial allocation in the 32.2°C environment ameliorated these effects and increased the fatty acid saturation to match the 23.9°C-housed pigs. The effects of spatial allocation on carcass quality demonstrate that challenging pigs with elevated temperature and reduced spatial allocation decreased feed intake, as demonstrated in the literature (Kerr et al., 2005Go), and also decreased carcass lipid firmness. The negative effects of temperature were partially ameliorated by increasing spatial allocation.

Data from this study indicate that both temperature and spatial allocation affected growth performance and carcass quality. Temperature stress decreased ADG, ADFI, and G:F ratios. Pigs housed at minimum required spatial allocation of 0.66 m2/pig (NCR-89, 1983) and high environmental temperatures had a 50% reduction in ADFI and an 85% reduction in ADG when compared with pigs housed in their thermal neutral zone; when pigs were housed at increased spatial allocation (0.93 m2/pig) and a temperature above 23.9°C, there was a 29% reduction of ADFI and a 36% reduction in ADG. These relationships demonstrate that almost 50% of the negative growth performance effects of temperature can be ameliorated by a 28% increase in spatial allocation. In addition, an increase in housing allocation during heat stress may ameliorate the negative effects of temperature on belly weight, carcass quality, and growth performance.

1 Corresponding author: mlatour{at}purdue.edu

Received for publication December 13, 2007. Accepted for publication March 3, 2008.


   LITERATURE CITED
Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 


AOAC. 1990. Official Methods of Analysis. 15th ed. Assoc. Offic. Anal. Chem., Arlington, VA.

Azain, M. J. 2001. Fat in swine nutrition. Page 95 in Swine Nutrition. 2nd ed. A. J. Lewis and L. L. Southern, ed. CRC Press, Boca Raton, FL.

Breinekova, K., M. Svoboda, M. Smutna, and L. Vorlova. 2006. Markers of acute stress in pigs. Physiol. Res. 56:323–329.[Medline]

Brumm, M. C., and P. S. Miller. 1996. Response of pigs to space allocation and diets varying in nutrient density. J. Anim. Sci. 74:2730–2737.[Abstract]

Cannon, J. E., J. B. Morgan, F. K. McKeith, G. C. Smith, S. Sonka, J. Heavner, and D. L. Meeker. 1996. Pork chain quality audit survey: Quantification of pork quality characteristics. J. Muscle Foods 7:29–44.[CrossRef]

Chomczynski, P. N., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156–167.[Medline]

Chrousos, G. P. 2007. Adrenocorticosteroids and adrenocortical antagonists. Pages 635–652 in Basic and Clinical Pharmacology. 10th ed. B. G. Katzung, ed. McGraw-Hill, New York, NY.

Collin, A., J. van Milgen, S. Dubois, and J. Noblet. 2001. Effect of high temperature on feeding behavior and heat production in group-housed young pigs. Br. J. Nutr. 86:63–70.[Medline]

Dobrzyn, A., and J. M. Ntambi. 2005. The role of stearoyl-CoA desaturase in the control of metabolism. Prostaglandins Leukot. Essent. Fatty Acids 73:35–41.[CrossRef][Medline]

Eggert, J. M., M. A. Belury, A. Kempa-Steczko, S. E. Mills, and A. P. Schinckel. 2001. Effects of conjugated linoleic acid on the belly firmness and fatty acid composition of genetically lean pigs. J. Anim. Sci. 79:2866–2872.[Abstract/Free Full Text]

Gonyou, H. W., and W. R. Stricklin. 1998. Effects of floor area allowance and group size on the productivity of growing/finishing pigs. J. Anim. Sci. 76:1326–1330.[Abstract/Free Full Text]

Gordon, L. M., A. D. Cox, A. Schinckel, and M. A. Latour. 2005. Case study: Evaluating the fatty acid distribution of bratwurst in retail products and of fat in sows fed Fertilium-treated diets. Prof. Anim. Sci. 21:232–238.[Abstract/Free Full Text]

Kerr, C. A., L. R. Giles, M. R. Jones, and A. Reverter. 2005. Effects of grouping unfamiliar cohorts, high ambient temperature and stocking density on live performance of growing pigs. J. Anim. Sci. 83:908–915.[Abstract/Free Full Text]

Kornegay, E. T., J. B. Meldrum, and W. R. Chickering. 1993. Influence of floor space allowance and dietary selenium and zinc on growth performance, clinical pathology measurments and liver enzymes, and adrenal weights of weanling pigs. J. Anim. Sci. 71:3185–3198.[Abstract]

Kouba, M., D. Hermier, and J. Le Dividich. 1999. Influence of a high ambient temperature on stearoyl-CoA desaturase activity in the growing pig. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 124:7–13.[CrossRef][Medline]

Kouba, M., D. Hermier, and J. Le Dividich. 2001. Influence of a high ambient temperature on lipid metabolism in the growing pig. J. Anim. Sci. 79:81–87.[Abstract/Free Full Text]

Kyrou, I., G. P. Chrousos, and C. Tsigos. 2006. Stress, visceral obesity, and metabolic complications. Ann. N. Y. Acad. Sci. 1083:77–110.[CrossRef][Medline]

Le Bellego, L., J. van Milgen, and J. Noblet. 2002. Effect of high temperature and low-protein diets on the performance of growing-finishing pigs. J. Anim. Sci. 80:691–701.[Abstract/Free Full Text]

Lopez, J., G. W. Jesse, B. A. Becker, and M. R. Ellersieck. 1991. Effects of temperature on the performance of finishing swine: I. Effects of a hot, diurnal temperature on average daily gain, feed intake, and feed efficiency. J. Anim. Sci. 69:1843–1849.[Abstract]

Madsen, A., K. Jakoben, and H. P. Mortensen. 1992. Influence of dietary fat on carcass fat quality in pigs. A review. Acta Agric. Scand. Sect. A. Anim. Sci. 42:220–225.

Marcous, M., C. Pomar, L. Faucitano, and C. Brodeur. 2007. The relationship between different pork carcass lean yield definitions and the market carcass value. Meat Sci. 75:94–102.[CrossRef]

Myer, R., and R. Bucklin. 2001. Influence of hot-humid environment on growth performance and reproduction of swine. http://edis.ifas.ufl.edu/AN107 Accessed May 30, 2007.

Nakamura, M. T., and T. Y. Nara. 2004. Structure, function and dietary regulation of {Delta}6, {Delta}5, and {Delta}9 desaturases. Annu. Rev. Nutr. 24:345–376.[CrossRef][Medline]

NCR-89. 1993. Space requirements of barrows and gilts penned together from 54 to 113 kilograms. J. Anim. Sci. 71:1088–1091.[Abstract]

Nienaber, J. A., G. L. Hahn, and R. A. Eigenberg. 1999. Quantifying livestock responses for heat-stress management: A review. Int. J. Biometeorol. 42:183–188.[CrossRef][Medline]

NPB. 2000. Pork composition and quality assessment procedures. Natl. Pork Board, Des Moines, IA.

NRC. 1998. Nutrient Requirements of Swine. 10th rev. ed. Natl. Acad. Press, Washington, DC.

Person, R. C., D. R. McKenna, D. B. Griffin, F. K. McKeith, J. A. Scanga, K. E. Belk, G. C. Smith, and J. W. Savell. 2005. Benchmarking value in the pork supply chain: Processing characteristics and consumer evaluations of pork bellies of different thicknesses when manufactured into bacon. Meat Sci. 70:121–131.[CrossRef]

Semenkovich, C. F. 1997. Regulation of fatty acid synthase (FAS). Prog. Lipid Res. 36:43–53.[CrossRef][Medline]

Smith, J., M. Al-Amri, P. Dorairaj, and A. Sniderman. 2006. The adipocyte life cycle hypothesis. Clin. Sci. 110:1–9.[CrossRef][Medline]

Smith, S. B., T. S. Hively, G. M. Cortese, J. J. Han, K. Y. Chung, P. Castenada, C. D. Gilbert, V. L. Adams, and H. J. Mersmann. 2002. Conjugated linoleic acid depresses the {Delta}9 desaturase index and stearoyl coenzyme A desaturase enzyme activity in porcine subcutaneous adipose tissue. J. Anim. Sci. 80:2110–2115.[Abstract/Free Full Text]

Stetzer, A. J., and F. K. McKeith. 2003. Benchmarking value in the pork supply chain: Quantification strategies and opportunities to improve quality: Phase I. Am. Meat Sci. Assoc., Savoy, IL.

Verstegen, M. W. A., W. H. Close, I. B. Start, and L. E. Mount. 1973. The effects of environmental temperature and plane of nutrition on heat loss, energy retention and deposition of protein and fat in groups of growing pigs. Br. J. Nutr. 30:21–35.[CrossRef][Medline]

Woessner, J. F. Jr. 1961. The determination of hydroxyproline in tissue and protein samples containing small proportions of this imino acid. Arch. Biochem. Biophys. 93:440–447.[CrossRef][Medline]

Wolter, B. F., M. Ellis, B. P. Corrigan, J. M. DeDecker, S. E. Curtis, E. N. Parr, and D. M. Webel. 2003. Impact of early postweaning growth rate as affected by diet complexity and space allocation on subsequent growth performance of pigs in a wean-to-finish production system. J. Anim. Sci. 81:353–359.[Abstract/Free Full Text]

Wolter, B. F., M. Ellis, J. M. DeDecker, S. E. Curtis, G. R. Hollis, R. D. Shanks, E. N. Parr, and D. M. Webel. 2002. Effects of double stocking and weighing frequency on pig performance in wean-to-finish production systems. J. Anim. Sci. 80:1442–1450.[Abstract/Free Full Text]

Wood, J. D., R. I. Richardson, G. R. Nute, A. V. Fisher, M. M. Campo, E. Kasapidou, P. R. Sheard, and M. Enser. 2003. Effects of fatty acids on meat quality: A review. Meat Sci. 66:21–32.[CrossRef]



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jas.2007-0801v1
86/8/1789    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by White, H. M.
Right arrow Articles by Latour, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by White, H. M.
Right arrow Articles by Latour, M. A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS