J. Anim Sci.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J. Anim Sci. 2007. 85:1651-1659. doi:10.2527/jas.2006-755
© 2007 American Society of Animal Science

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jas.2006-755v1
85/7/1651    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, B.
Right arrow Articles by Lee, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, B.
Right arrow Articles by Lee, K.

ANIMAL GROWTH, PHYSIOLOGY, AND REPRODUCTION

Heart fatty acid binding protein is upregulated during porcine adipocyte development1

B. Li, H. N. Zerby and K. Lee2

Department of Animal Sciences, Ohio State University, Columbus, OH 43210


    Abstract
 Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Heart fatty acid binding protein (H-FABP) has been associated with intramuscular fat content in pigs. In the current study, we showed that expression of H-FABP mRNA in adipose tissue of adult pigs was 8.5% of that in heart and 30% of that in skeletal muscle, and that H-FABP mRNA level was more than 10% of that of adipocyte fatty acid binding protein mRNA in adipose tissue. Levels of H-FABP mRNA reached a maximum in adipose tissue from 7-d neonates, with no further increase in the adult. Also, H-FABP mRNA was induced during adipogenic differentiation of stromal-vascular cells derived from adipose tissue and skeletal muscle. In conclusion, H-FABP may play a role in adipose tissue development and function in the pig.

Key Words: adipocyte fatty acid binding protein • adipose tissue • heart fatty acid binding protein • skeletal muscle


    INTRODUCTION
 Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Heart fatty acid binding protein (H-FABP) is a member of the family of intracellular fatty acid binding proteins (Chmurzynska, 2006Go). In rats and mice, H-FABP has been more thoroughly studied than in pigs (Heuckeroth et al., 1987Go; Binas et al., 1999Go, 2003Go). The H-FABP is widely distributed, with the greatest expression in the heart and skeletal muscle and lower expression in adipose tissue, kidney, and brain (Heuckeroth et al., 1987Go). Developmental regulation of H-FABP mRNA has been demonstrated in the rat heart, brain, kidney, and other tissues. In particular, H-FABP mRNA was upregulated during heart development, with a peak on approximately postnatal d 14 (Heuckeroth et al., 1987Go).

Functionally, H-FABP has been shown to be involved in fatty acid uptake and utilization in the heart and skeletal muscle as demonstrated by H-FABP-deficient mice (Binas et al., 1999Go, 2003Go). Compared with rodents, much less is known about H-FABP in the pig, particularly in adipose tissue. Genetic variations in H-FABP gene loci have been associated with intramuscular fat in pigs (Gerbens et al., 1999Go, 2000Go). It is known that intramuscular fat content is an important aspect of meat quality in pork because it is positively correlated with palatability.

The objective of this investigation was to study the expression of H-FABP during pig adipocyte development. In addition, we also evaluated the maturity of intramuscular and subcutaneous adipose tissue by examining the expression of H-FABP as well as other adipose marker genes in both tissues.


    MATERIALS AND METHODS
 Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
The Institutional Animal Care and Use Committee approved all procedures involving animal handling.

Tissue Harvest
Subcutaneous adipose tissue was collected from the dorsal neck region of 75-d-old fetal, 7-d-old neonatal, and 5-mo-old adult pigs (n = 3 per age group). From the 5-mo-old adult pigs, liver, skeletal muscle, heart, lung, intestine, spleen, and kidney were also collected (n = 3). From 3-mo-old adult pigs (n = 3), intramuscular adipose tissue was carefully dissected from skeletal muscle, and subcutaneous adipose tissue was also collected as the control.

Isolation and Differentiation of Primary Stromal-Vascular Cells
The stromal-vascular cell fraction from subcutaneous adipose tissue was isolated from 7-d-old neonatal pigs according to previously reported methods (Hausman and Poulos, 2004Go, 2005Go). Subcutaneous adipose tissue from 7-d-old neonates were minced into fine pieces and digested with 3.2 mg of type-II collagenase/mL (cat. No. C1764, activity > 125 collagen digestion units/mg, Sigma-Aldrich Co., St. Louis, MO) in Dulbecco’s modified Eagle’s medium (Invitrogen, Carlsbad, CA) at 37°C in a shaking water bath for 1 h and was filtered through sterile nylon mesh (100-µm pore size) to remove undigested tissue. The filtrate was centrifuged at 500 x g for 5 min, and stromal-vascular cells were collected and cultured in Dulbecco’s modified Eagle’s medium (0.5 x 105 cells per 35-mm culture dish) containing 10% fetal bovine serum (Invitrogen). At approximately 90% confluence, the cells were treated with 80 nM dexamethasone (Sigma-Aldrich Co.) for 3 d followed by 5 µg of insulin/mL, 5 µg of transferrin/mL, and 5 ng of selenium/mL (all from Sigma-Aldrich Co.) for 6 d to promote differentiation into adipocytes. The cells were collected at d 0, 3, 6, and 9 after differentiation for RNA and protein evaluation (n = 3 cultures per day, each culture from 1 pig). Stromal-vascular cells were also isolated from skeletal muscle of 7-d-old neonatal pigs and differentiated into adipocytes using the same method as described above. The cells were collected at d 0, 6, and 9 after differentiation for RNA and protein evaluation (n = 4 cultures per day, each culture from 1 pig). At d 9, a separate dish of differentiated cells was stained with hematoxylin and photographed using a bright-field microscope.

RNA Isolation and Reverse Transcription
Total RNA from tissue or cells was isolated using Trizol (Invitrogen) following the manufacturer’s instructions. The quantity and quality of RNA were evaluated by agarose gel and 1 µg of RNA was used in each reverse transcription. Reverse transcription was performed using M-MLV reverse transcriptase (In-vitrogen); the conditions for reverse transcription were 65°C for 5 min, 37°C for 50 min, and 70°C for 15 min.

Cloning of Cyclophilin, H-FABP, and A-FABP into pCR2.1 Vector
Cyclophilin and adipocyte fatty acid binding protein (A-FABP) were amplified from adult pig adipose tissue, and H-FABP was amplified from adult pig skeletal muscle by reverse transcription-PCR. The sequences of the PCR primers were as follows:

cyclophilin,

forward 5'GGATAATTTTGTGGCCTTGGC3',

reverse 5'ACTGGGAGCCATTGGTGTCT3';

H-FABP,

forward 5'GCCAACATGACCAAGCCTACC3',

reverse 5'CATGGGTGAGTGTCAGGATGAG3'; and

A-FABP,

forward 5'ATTGGGCCAGGAATTTGATG3',

reverse 5'TCTGGTAGCCGTGACACCTTT3'.

The PCR was performed using Taq polymerase (In-vitrogen), with the following conditions: 94°C for 2 min; 40 cycles of 94°C for 20 s, 56°C for 30 s, and 72°C for 1 min; and 72°C for 10 min. The products of PCR were cloned into a pCR2.1 vector using a TATA cloning kit (Invitrogen), and plasmids containing the respective insert were subjected to sequence analysis to verify amplification of the correct cDNA. The plasmids were then quantified and used as the standard for SYBR Green, real-time PCR.

Quantitative, SYBR Green, Real-Time PCR
Cyclophilin, H-FABP, A-FABP, delta-like homolog 1 (DLK1), and peroxisome proliferator activated receptor {gamma}(PPAR-{gamma}) were quantified by SYBR Green, real-time reverse transcription-PCR. The sequences of the real-time PCR primers were as follows:

cyclophilin, H-FABP, and A-FABP were the same as described above;

DLK1,

forward 5'CCCATGGAGCTGAATGCCT,

reverse 5'TTGCAAATGCACTGCCAGGG3';

PPAR-{gamma},

forward 5'TAGATGACAGCGACCTGGCGA,

reverse 5'AGCAGCTTAGCAAAGAGCTGG3'.

Cyclophilin was used as an internal control.

The PCR was performed using AmpliTaq Gold polymerase (Applied Biosystems, Foster City, CA) and SYBR Green was used as the detection dye. The conditions for real-time PCR were 95°C for 10 min; 40 cycles of 94°C for 20 s, 58°C for 30 s, 72°C for 40 s; and 82°C for 16 s. The pCR2.1 plasmids containing cyclophilin, H-FABP, or A-FABP were used as the standards, and gene expression was presented as the number of copies of target gene per copy of cyclophilin. For DLK1 and PPAR-{gamma}, relative gene expression was presented as a ratio of DLK1 or PPAR-{gamma} to cyclophilin.

Western Blot of PPAR-{gamma}, Myosin Heavy Chain, and ß-Actin
Cells were homogenized in 1x Laemmli buffer (62.5 mM Tris, 1% SDS, 5% 2-mecaptoethanol, 12.5% glycerol, 0.05% bromophenol blue; BioRad Laboratories, Hercules, CA). The proteins were separated using SDS-PAGE, transferred to a polyvinylidene fluoride membrane (Amersham Biosciences, Piscataway, NJ), and the membrane was blocked with 5% nonfat dry milk in Tris-buffered saline-Tween (TBST; 20 mM Tris, 150 mM NaCl, pH 7.4, plus 0.1% Tween-20) at room temperature for 1 h. The membrane was incubated for 2 h at room temperature with primary antibodies to PPAR-{gamma} (1:1,000 dilution; sc-7273, Santa Cruz Biotechnology Inc., Santa Cruz, CA), myosin heavy chain (1:1,000 dilution; Developmental Studies Hybridoma Bank, University of Iowa, Iowa City), or ß-actin (1:4,000 dilution; Santa Cruz Biotechnology Inc.). The primary antibody to PPAR-{gamma} reacted with mouse and porcine PPAR-{gamma}, and detected PPAR-{gamma}1 and PPAR-{gamma}2 isoforms (data not shown). The membrane was washed with TBST 5 times and then was incubated with horseradish peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology Inc.) at room temperature for 1 h. The membrane was washed with TBST another 5 times, and the proteins were detected with ECL plus (Amersham Biosciences) followed by exposure to BioMax x-ray film (Amersham Biosciences).

Statistical Analysis
The data were presented as means ± SEM. The data were analyzed by 1-way ANOVA. Statistical differences were set at P < 0.05.


    RESULTS
 Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Adipose Expression of H-FABP mRNA
As shown in Figure 1AGo, H-FABP and A-FABP mRNA were quantified in various adult pig tissues by real-time reverse transcription-PCR. In heart and skeletal muscle, H-FABP mRNA is highly expressed at 54 and 15.5 copies per copy of cyclophilin, respectively. In adipose tissue, H-FABP mRNA is moderately expressed at 4.6 copies per copy of cyclophilin. In other tissues including kidney, lung, liver, intestine, and spleen, H-FABP mRNA is lowly expressed at less than 1 to 2 copies per copy of cyclophilin (data not shown). In contrast to widely expressed H-FABP, A-FABP is mainly expressed in adipose tissue, muscle, and heart. In the adipose tissue, A-FABP mRNA is abundantly expressed at 41 copies per copy of cyclophilin. In muscle and heart, A-FABP is moderately expressed at 2 and 6 copies per copy of cyclophilin, respectively. In other tissues, A-FABP mRNA is very lowly expressed at less than 1 copy per 100 copies of cyclophilin (data not shown). In the adipose tissue, H-FABP mRNA was more than 10% of A-FABP mRNA. In Figure 1BGo, H-FABP and A-FABP mRNA were determined in subcutaneous adipose tissue from 75-d-old fetuses, 7-d-old neonatal pigs, and 5-mo-old adult pigs. To validate adipose tissue development at different stages, we examined DLK1 and PPAR-{gamma} mRNA expression. As an inhibitor of adipocyte differentiation, DLK1 is highly expressed in preadipocytes and dramatically decreases during adipocyte differentiation (Lee et al., 2003Go; Deiuliis et al., 2006Go). As a transcription factor that promotes adipocyte differentiation, PPAR-{gamma} is lowly expressed in preadipocytes and dramatically increases during differentiation into adipocytes (Chawla et al., 1994Go; Tontonoz et al., 1995Go; Ding et al., 1999Go). In this study, DLK1 was used as a preadipocyte marker and PPAR-{gamma} was used as an adipocyte marker to confirm the adipogenic differentiation. From fetus to adult, DLK1 mRNA decreased about 18-fold to minimal levels (P < 0.01), whereas PPAR-{gamma} mRNA increased 4.7-fold (P < 0.01), thus confirming adipose tissue development. In the adipose tissue of fetal, neonatal, and adult pig, H-FABP mRNA level was 0.07, 3.9, and 4.6 copies per copy of cyclophilin, respectively. Compared with fetus, H-FABP mRNA increased more than 50-fold after birth (P < 0.01). In the adipose tissue of fetal, neonatal, and adult pig, A-FABP mRNA level was 1.3, 39, and 41 copies per copy of cyclophilin, respectively. Compared with fetus, A-FABP mRNA increased about 30-fold after birth (P < 0.05). At d 7 after birth, both H-FABP and A-FABP mRNA reached a maximum with no further increase in the adult. Both H-FABP and A-FABP are developmentally upregulated in a similar pattern in adipose tissue.


Figure 1
View larger version (11K):
[in this window]
[in a new window]

 
Figure 1. Adipose tissue expression of heart fatty acid binding protein (H-FABP) mRNA. A) Expression of H-FABP and adipocyte fatty acid binding protein (A-FABP) mRNA in subcutaneous adipose tissue (fat), skeletal muscle (muscle), and heart in adult pigs. B) For fetuses (fetus), 7-d-old neonatal pigs (7-d), and adult pigs (adult), expression of H-FABP mRNA (P < 0.01), A-FABP mRNA (P < 0.05), delta-like homolog 1 (DLK1) mRNA (P < 0.01), and peroxisome proliferator activated receptor-{gamma} (PPAR-{gamma}) mRNA (P < 0.01) in subcutaneous adipose tissue. The bars indicate means ± SEM (n = 3 pigs). The mRNA expression of each gene was determined by real-time reverse transcription-PCR and was expressed as a ratio to cyclophilin mRNA. The H-FABP and A-FABP mRNA were presented as the number of copies per copy of cyclophilin; PPAR-{gamma} and DLK1 mRNA were expressed as a ratio to that of cyclophilin (cyc).

 
Adipogenic Differentiation of Stromal-Vascular Cells from Adipose Tissue
Stromal-vascular cells from 7-d-old neonatal pig subcutaneous adipose tissue were differentiated into adipocytes. At d 9 after differentiation, more than 60% of the cells differentiated into mature adipocytes, which were characterized by accumulation of lipid droplets within the cells under the light microscope. In addition, the time-dependent increase of PPAR-{gamma} mRNA (P < 0.001) as well as the induction of PPAR-{gamma} protein confirmed adipogenic differentiation of stromal-vascular cells (Figure 2BGo). As shown in Figure 2AGo, at d 0, H-FABP and A-FABP mRNA were expressed at very low levels at less than 1 copy per 10 copies of cyclophilin. At d 9, H-FABP mRNA had increased up to 160-fold of the level at d 0 (P < 0.0001), and A-FABP mRNA had increased up to 67-fold of the level at d 0 (P < 0.001). The induction of H-FABP mRNA exhibited a similar pattern to that of A-FABP mRNA during the adipogenic differentiation of stromal-vascular cells derived from adipose tissue.


Figure 2
View larger version (13K):
[in this window]
[in a new window]

 
Figure 2. Expression of A) heart fatty acid binding protein (H-FABP) mRNA (P < 0.0001) and adipocyte fatty acid binding protein (A-FABP) mRNA (P < 0.001), and B) peroxisome proliferator activated receptor-{gamma} (PPAR-{gamma}) mRNA (P < 0.001) and PPAR-{gamma} protein from d 0 to 9 during adipogenic differentiation of adipose stromal-vascular cells. The bars indicate means ± SEM (n = 3 cultures, each culture from 1 pig). The mRNA expression of each gene was determined by real-time reverse transcription-PCR and expressed as a ratio to cyclophilin mRNA. The H-FABP and A-FABP mRNA were presented as the number of copies per copy of cyclophilin, and PPAR-{gamma} mRNA was expressed as a ratio to that of cyclophilin (cyc). The PPAR-{gamma} protein was detected by Western blot, and ß-actin was used as an internal control.

 
Adipogenic Differentiation of Stromal-Vascular Cells from Skeletal Muscle
Stromal-vascular cells from skeletal muscle of 7-d neonatal pigs were further isolated and then differentiated into adipocytes. At d 9, about 20% of the cells were differentiated into adipocytes characterized by lipid accumulation in the cells (Figure 3AGo). From d 0 to 9, PPAR-{gamma} mRNA (P < 0.05; Figure 3BGo) and PPAR-{gamma} protein (Figure 3CGo) were greatly induced, which confirmed adipogenic differentiation of stromal-vascular cells from skeletal muscle. As shown in Figure 3BGo, at d 0, 6, and 9, H-FABP mRNA was 0.1, 2.5, and 1.4 copies per copy of cyclophilin, respectively. After differentiation, H-FABP mRNA increased more than 10-fold (P < 0.05). On the other hand, at d 0, 6, and 9, A-FABP mRNA was 0.0003, 0.3, and 0.9 copies per copy of cyclophilin, respectively. The A-FABP mRNA also increased from minimal levels after differentiation (P < 0.05). To rule out the possibility that H-FABP was derived from myogenic differentiation, myotube formation was examined by microscopic image, and there was no formation of myotubes in this cell culture (Figure 3AGo). Myosin heavy chain protein was examined by Western blot and skeletal muscle from the adult pig was used as a positive control. The myosin heavy chain expression was detected in the muscle, but not in the cell culture at d 0, 6, and 9 (Figure 3CGo). Thus, the induction of H-FABP mRNA was attributed to adipogenesis, but not myogenesis.


Figure 3
View larger version (66K):
[in this window]
[in a new window]

 
Figure 3. A) Muscle stromal-vascular cells at d 9 after adipogenic differentiation by phase-contrast microscopy. Magnification = 100x (top) or 200x (bottom). The white box in the top panel indicates the area shown in the bottom panel. B) Expression of heart fatty acid binding protein (H-FABP) mRNA (P < 0.05), adipocyte fatty acid binding protein (A-FABP) mRNA (P < 0.05), and peroxisome proliferator activated receptor-{gamma} (PPAR-{gamma}) mRNA (P < 0.05) from d 0 to 9 during adipogenic differentiation of muscle stromal-vascular cells. The bars indicate means ± SEM (n = 4 cultures, each culture from 1 pig). The mRNA expression of each gene was determined by real-time reverse transcription-PCR and expressed as a ratio to cyclophilin mRNA. The H-FABP and A-FABP mRNA were presented as the number of copies per copy of cyclophilin, and PPAR-{gamma} mRNA was expressed as a ratio to that of cyclophilin (cyc). C) Western blot of PPAR-{gamma} and myosin heavy chain (MHC) protein from d 0 to 9 during adipogenic differentiation of muscle stromal-vascular cells. Skeletal muscle (M) was used as a positive control for MHC, and ß-actin was used as an internal control.

 
Expression in Intramuscular Adipose Tissue
As shown in Figure 4Go, expression of DLK1 in intramuscular adipose tissue was 25-fold of that in subcutaneous adipose tissue (P = 0.07). In contrast, PPAR-{gamma} mRNA in subcutaneous adipose tissue was 16-fold of that in intramuscular adipose tissue (P < 0.05). The level of H-FABP and A-FABP mRNA expression in intramuscular adipose tissue was 0.8 and 5.8 copies per copy of cyclophilin, respectively, which was 16 and 18% of the respective mRNA level in subcutaneous adipose tissue. Both H-FABP and A-FABP mRNA expression were lower in intramuscular adipose tissue compared with subcutaneous adipose tissue (P < 0.05 and P < 0.01, respectively). Taken together, these results suggest that intramuscular adipose tissue contains less mature adipocytes than subcutaneous adipose tissue.


Figure 4
View larger version (13K):
[in this window]
[in a new window]

 
Figure 4. Expression of heart fatty acid binding protein (H-FABP) mRNA (P < 0.05), adipocyte fatty acid binding protein (A-FABP) mRNA (P < 0.01), delta-like homolog 1 (DLK1) mRNA (P = 0.07), and peroxisome proliferator activated receptor-{gamma} (PPAR-{gamma}) mRNA (P < 0.05) in subcutaneous adipose tissue (SF) and intramuscular adipose tissue (IMF). The bars indicate means ± SEM (n = 3 pigs). The mRNA expression of each gene was determined by real-time reverse transcription-PCR and expressed as a ratio to cyclophilin mRNA. The H-FABP and A-FABP mRNA were presented as the number of copies per copy of cyclophilin; DLK1 and PPAR-{gamma} mRNA were expressed as a ratio to that of cyclophilin (cyc).

 

    DISCUSSION
 Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
In this study, we characterized the regulation of H-FABP and A-FABP mRNA during adipose tissue development and adipogenesis in cell culture by real-time reverse transcription-PCR. This report is the first to quantitatively compare pig H-FABP and A-FABP mRNA under various conditions and provide evidence to support that H-FABP may play an important role in pig adipose tissue. First, we reexamined tissue distribution of H-FABP and A-FABP mRNA in adult pigs. In agreement with previous reports (Heuckeroth et al., 1987Go; Armstrong et al., 1990Go; Ding et al., 1999Go), H-FABP is strongly expressed in heart and skeletal muscle, and A-FABP is strongly expressed in adipose tissue. Surprisingly, H-FABP mRNA was also detected in adipose tissue at a moderate level, and H-FABP mRNA in adipose tissue was 8.5% of heart levels and 30% of skeletal muscle levels. On the other hand, in addition to adipose tissue, A-FABP mRNA is also expressed in heart and muscle at moderate levels. It is interesting to note that FABP profile in adipose tissue of pigs is quite different from that of mice. In both species, A-FABP has been known as the predominant intracellular fatty acid binding protein in adipose tissue (Bernlohr et al., 1985Go; Armstrong et al., 1990Go). In mouse white adipose tissue, keratinocyte fatty acid binding protein (mal1) mRNA was moderately expressed and H-FABP mRNA was very lowly expressed, whereas in brown adipose tissue, H-FABP mRNA was highly expressed and mal1 mRNA was very lowly expressed (Maeda et al., 2003Go). In pig adipose tissue, H-FABP mRNA reached 10% of A-FABP mRNA level. The moderate expression of H-FABP mRNA we detected in pig adipose tissue was in agreement with a recent report, and H-FABP mRNA expression seemed to be much greater than epidermal fatty acid binding protein (E-FABP, mal1) mRNA (Chen et al., 2006Go). Developmental regulation of H-FABP in the heart, kidney, and brain has been well characterized in rats (Heuckeroth et al., 1987Go). However, developmental changes of H-FABP in adipose tissue have not been examined. This research has shown that the changes of H-FABP in pig adipose tissue follow a similar trend as previously reported in the rat heart (Heuckeroth et al., 1987Go). More interestingly, H-FABP exhibited a parallel pattern of upregulation similar to that of A-FABP during adipose tissue development. The moderate expression and developmental upregulation of H-FABP suggest that H-FABP may play an important role in pig adipose tissue.

Differentiation of stromal-vascular cells into adipocytes has been used as an in vitro model to study regulation of genes during adipogenic differentiation. We examined H-FABP and A-FABP mRNA during the differentiation of pig adipose stromal-vascular cells into adipocytes. Adipogenesis was verified by morphological observation of lipid accumulation within the cells and induction of PPAR-{gamma} at mRNA and protein levels. Consistent with previous reports (Bernlohr et al., 1984Go; Ding et al., 1999Go), A-FABP mRNA was increased during adipogenic differentiation. Similar to A-FABP, H-FABP mRNA exhibited a parallel pattern of upregulation during differentiation. The induction of H-FABP mRNA during in vitro adipogenesis indicates that H-FABP may play an important role in pig adipose tissue function.

The stromal-vascular cells from skeletal muscle of neonatal pigs contain different types of cells, of which preadipocytes and satellite cells are capable of adipogenic differentiation (Asakura et al., 2001Go; Hausman and Poulos, 2004Go, 2005Go). We differentiated muscle stromal-vascular cells into adipocytes, which was confirmed by observation of lipid droplets and induction of PPAR-{gamma} at mRNA and protein levels. Consistent with a previous report, the degree of differentiation from muscle stromal-vascular cells was much lower than from adipose stromal-vascular cells (Hausman and Poulos, 2004Go). Correspondingly, A-FABP mRNA level in differentiated muscle stromal-vascular cells was only 14% of A-FABP mRNA in differentiated adipose stromal-vascular cells. The basal level of H-FABP mRNA in muscle stromal-vascular cells was about 10-fold of the level in adipose stromal-vascular cells. During muscle stromal-vascular cell differentiation, H-FABP mRNA was induced more than 10-fold and H-FABP mRNA expression reached a similar level to that of A-FABP mRNA. Because H-FABP can be greatly induced during differentiation of myoblasts into myotubes (Rump et al., 1996Go), the absence of muscle cell marker myosin heaven chain in differentiated stromal-vascular cells demonstrated that H-FABP induction was derived from adipogenesis instead of myogenesis. Therefore, H-FABP may have an important role in the development of intramuscular adipocytes. Altogether, the upregulation of H-FABP during in vivo adipose tissue development and in vitro adipogenic differentiation indicate that H-FABP may play an important role in pig adipocyte function.

Genetic variations of H-FABP gene have been associated with intramuscular fat content in pigs (Gerbens et al., 1999Go, 2000Go). In addition, H-FABP mRNA expression was significantly different between H-FABP HaeIII genotypes and was significantly related with intramuscular fat (Gerbens et al., 2001Go). However, other studies failed to detect significant associations of H-FABP gene with intramuscular fat content (Nechtelberger et al., 2001Go; Urban et al., 2002Go). In 1 study, there was no effect of H-FABP genetic variants on intramuscular fat in 3 Austrian breeds including Landrace, Large White, and Piétrain (Nechtelberger et al., 2001Go). In another study, the HinfI polymorphisim of H-FABP did not affect intramuscular fat in Large White and Landrace breeds (Urban et al., 2002Go). To date, the association of H-FABP with intramuscular fat has been inconclusive. In the current study, we compared H-FABP and A-FABP mRNA levels in subcutaneous and intramuscular adipose tissue. The high DLK1 and low PPAR-{gamma} mRNA expression in intramuscular fat indicated that the intramuscular adipose tissue was less mature than the subcutaneous adipose tissue. Correspondingly, less H-FABP and A-FABP mRNA were expressed in intramuscular adipose tissue, and both genes may be associated with adipose tissue development.

In summary, our results provide evidence to support that, in addition to A-FABP, H-FABP is moderately expressed in pig adipose tissue and the level of H-FABP appears to be associated with the maturity of the adipose tissue. Furthermore, H-FABP is upregulated in a parallel pattern as A-FABP during adipose tissue development as well as adipogenic differentiation of stromal-vascular cells. We conclude that H-FABP may be required for pig adipose tissue function. However, the function of H-FABP in pig adipose tissue remains unknown. In mice, H-FABP deficiency resulted in reduced fatty acid uptake and utilization in heart and muscle, H-FABP was greatly increased during cold-induced thermogenesis in mouse brown adipose tissue; thus, H-FABP is involved in fatty acid utilization for energy production (Daikoku et al., 1997Go; Binas et al., 1999Go; Binas et al., 2003Go). Based on the evidence from the mouse study, we speculate that H-FABP may play a similar role in fatty acid utilization for energy production in pig adipose tissue as in the mouse heart, muscle, and brown adipose tissue, which needs to be investigated in future studies.


    Footnotes
 
1 This study was supported by the Ohio Agricultural Research and Development Center. Back

2 Corresponding author: lee.2626{at}osu.edu

Received for publication November 14, 2006. Accepted for publication April 4, 2007.


    LITERATURE CITED
 Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 


Armstrong, M. K., D. A. Bernlohr, J. Storch, and S. D. Clarke. 1990. The purification and characterization of a fatty acid binding protein specific to pig (sus domesticus) adipose tissue. Biochem. J. 267:373–378.[Medline]

Asakura, A., M. Komaki, and M. A. Rudnicki. 2001. Muscle satellite cells are multipotential stem cells that exhibit myogenic, osteogenic, and adipogenic differentiation. Differentiation 68:245–253.[CrossRef][Medline]

Bernlohr, D. A., C. W. Angus, M. D. Lane, M. A. Bolanowski, and T. J. Kelly, Jr. 1984. Expression of specific mRNAs during adipose differentiation: Identification of an mRNA encoding a homologue of myelin p2 protein. Proc. Natl. Acad. Sci. USA 81:5468–5472.[Abstract/Free Full Text]

Bernlohr, D. A., T. L. Doering, T. J. Kelly, Jr., and M. D. Lane. 1985. Tissue specific expression of p422 protein, a putative lipid carrier, in mouse adipocytes. Biochem. Biophys. Res. Commun. 132:850–855.[CrossRef][Medline]

Binas, B., H. Danneberg, J. McWhir, L. Mullins, and A. J. Clark. 1999. Requirement for the heart-type fatty acid binding protein in cardiac fatty acid utilization. FASEB J. 13:805–812.[Abstract/Free Full Text]

Binas, B., X. X. Han, E. Erol, J. J. F. P. Luiken, J. F. C. Glatz, D. J. Dyck, R. Motazavi, P. J. Adihetty, D. A. Hood, and A. Bonen. 2003. A null mutation in H-FABP only partially inhibits skeletal muscle fatty acid metabolism. Am. J. Physiol. Endocrinol. Metab. 285:E481–E489.[Abstract/Free Full Text]

Chawla, A., E. J. Schwarz, D. D. Dimaculangan, and M. A. Lazar. 1994. Peroxisome proliferator-activated receptor (PPAR) gamma: Adipose-predominant expression and induction early in adipocyte differentiation. Endocrinology 135:798–800.[Abstract]

Chen, C. H., E. C. Lin, W. T. K. Cheng, H. S. Sun, H. J. Mersmann, and S. T. Ding. 2006. Abundantly expressed genes in pig adipose tissue: An expressed sequence tag approach. J. Anim. Sci. 84:2673–2683.[Abstract/Free Full Text]

Chmurzynska, A. 2006. The multigene family of fatty acid-binding proteins (FABPs): Function, structure and polymorphism. J. Appl. Genet. 47:39–48.[Medline]

Daikoku, T., Y. Shinohara, A. Shima, N. Yamazaki, and H. Terada. 1997. Dramatic enhancement of the specific expression of the heart-type fatty acid binding protein in rat brown adipose tissue by cold exposure. FEBS Lett. 410:383–386.[CrossRef][Medline]

Deiuliis, J. A., B. Li, P. A. Lyvers-Peffer, S. J. Moeller, and K. Lee. 2006. Alternative splicing of delta-like 1 homolog (DLK1) in the pig and human. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 145:50–59.[CrossRef][Medline]

Ding, S. T., R. L. McNeel, and H. J. Mersmann. 1999. Expression of porcine adipocyte transcripts: Tissue distribution and differentiation in vitro and in vivo. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 123:307–318.[CrossRef][Medline]

Gerbens, F., D. J. de Koning, F. L. Harders, T. H. E. Meuwissen, L. L. G. Janss, M. A. M. Groenen, J. H. Veerkamp, J. A. M. Van Arendonk, and M. F. W. te Pas. 2000. The effect of adipocyte and heart fatty acid-binding protein genes on intramuscular fat and backfat content in Meishan crossbred pigs. J. Anim. Sci. 78:552–559.[Abstract/Free Full Text]

Gerbens, F., A. J. M. van Erp, F. L. Harders, F. J. Verburg, T. H. E. Meuwissen, J. H. Veerkamp, and M. F. W. te Pas. 1999. Effect of genetic variants of the heart fatty acid-binding protein gene on intramuscular fat and performance traits in pigs. J. Anim. Sci. 77:846–852.[Abstract/Free Full Text]

Gerbens, F., F. J. Verburg, H. T. B. Van Moerkerk, B. Engel, W. Buist, J. H. Veerkamp, and M. F. W. te Pas. 2001. Associations of heart and adipocyte fatty acid-binding protein gene expression with intramuscular fat content in pigs. J. Anim. Sci. 79:347–354.[Abstract/Free Full Text]

Hausman, G. J., and S. Poulos. 2004. Recruitment and differentiation of intramuscular preadipocytes in stromal-vascular cell cultures derived from neonatal pig semitendinosus muscles. J. Anim. Sci. 82:429–437.[Abstract/Free Full Text]

Hausman, G. J., and S. P. Poulos. 2005. A method to establish co-cultures of myotubes and preadipocytes from collagenase digested neonatal pig semitendinosus muscles. J. Anim. Sci. 83:1010–1016.[Abstract/Free Full Text]

Heuckeroth, R. O., E. H. Birkenmeier, M. S. Levin, and J. I. Gordon. 1987. Analysis of the tissue-specific expression, developmental regulation, and linkage relationships of a rodent gene encoding heart fatty acid binding protein. J. Biol. Chem. 262:9709–9717.[Abstract/Free Full Text]

Lee, K., J. A. Villena, Y. S. Moon, K. H. Kim, S. Lee, C. Kang, and H. S. Sul. 2003. Inhibition of adipogenesis and development of glucose intolerance by soluble preadipocyte factor-1 (Pref-1). J. Clin. Invest. 111:453–461.[CrossRef][Medline]

Maeda, K., K. T. Uysal, L. Makowski, C. Z. Gorgun, G. Atsumi, R. A. Parker, J. Bruning, A. V. Hertzel, D. A. Bernlohr, and G. S. Hotamisligil. 2003. Role of the fatty acid binding protein mal1 in obesity and insulin resistance. Diabetes 52:300–307.[Abstract/Free Full Text]

Nechtelberger, D., V. Pires, J. Soolknet, I. Stur, G. Brem, M. Mueller, and S. Mueller. 2001. Intramuscular fat content and genetic variants at fatty acid-binding protein loci in Austrian pigs. J. Anim. Sci. 79:2798–2804.[Abstract/Free Full Text]

Rump, R., C. Buhlmann, T. Borchers, and F. Spener. 1996. Differentiation-dependent expression of heart type fatty acid-binding protein in C2C12 muscle cells. Eur. J. Cell Biol. 69:135–142.[Medline]

Tontonoz, P., E. Hu, and B. M. Spiegelman. 1995. Regulation of adipocyte gene expression and differentiation by peroxisome proliferator activated receptor gamma. Curr. Opin. Genet. Dev. 5:571–576.[CrossRef][Medline]

Urban, T., R. Mikolasova, J. Kuciel, M. Ernst, and I. Ingr. 2002. A study of associations of the H-FABP genotypes with fat and meat production of pigs. J. Appl. Genet. 43:505–509.[Medline]


This article has been cited by other articles:


Home page
Poult. Sci.Home page
K. Lee, J. Shin, J. D. Latshaw, Y. Suh, and J. Serr
Cloning of adipose triglyceride lipase complementary deoxyribonucleic acid in poultry and expression of adipose triglyceride lipase during development of adipose in chickens
Poult. Sci., March 1, 2009; 88(3): 620 - 630.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. Li, J. Shin, and K. Lee
Interferon-Stimulated Gene ISG12b1 Inhibits Adipogenic Differentiation and Mitochondrial Biogenesis in 3T3-L1 Cells
Endocrinology, March 1, 2009; 150(3): 1217 - 1224.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jas.2006-755v1
85/7/1651    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, B.
Right arrow Articles by Lee, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, B.
Right arrow Articles by Lee, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS