HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: jas.2006-711v1 85/6/1393    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Simsa, S. Articles by Ornan, E. M. Search for Related Content PubMed PubMed Citation Articles by Simsa, S. Articles by Ornan, E. M.

Matrix metalloproteinase expression and localization in turkey (Meleagris gallopavo) during the endochondral ossification process¹

S. Simsa^*, O. Genina and E. Monsonego Ornan^*,2,3

^* Department of Biochemistry and Nutrition, Faculty of Agricultural, Food and Environmental Quality Sciences, The Hebrew University, Rehovot, Israel; and and Institute of Animal Science, the Volcani Center, Bet Dagan 50250, Israel

	Abstract

Top Abstract INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION LITERATURE CITED

 
Vertebrate long bones are formed by endochondral ossification, a process accompanied by changes in extracellular matrix synthesis and remodeling, performed mainly by the matrix metalloproteinases (MMP). The temporal/spatial expression patterns of 5 members of the MMP family known to be important for endochondral ossification were studied, for the first time, in the turkey growth plate during embryonic and juvenile stages. The expression of MMP-2 was detected in the proliferative zone, MMP-3, MMP-9, and MMP-13 in cells lining the blood vessels; MMP-13 was also detected in hypertrophic chondrocytes. The MMP-16 expression was detected in the reserve zone of the growth plate. These results present a detailed survey of turkey MMP, serving as a data source (atlas) for further studies in this subject.

Key Words: endochondral ossification • growth-plate • matrix metalloproteinase • turkey

	INTRODUCTION

Top Abstract INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION LITERATURE CITED

 
The long bones of the fetal skeleton develop through the process of endochondral ossification, in which cartilage serves as the initial skeletal element and is later replaced by bone (DeLise et al., 2000). Further elongation occurs later in the growth plates (Tsumaki and Yoshikawa, 2005), which contain chondrocytes at different stages of differentiation, organized into several zones: resting, proliferative, prehypertrophic, and hypertrophic (Gerber and Ferrara, 2000).

During endochondral ossification, an avascular tissue (cartilage) is gradually converted into the most vascularized tissue in the vertebrate body (bone). Growth plate cartilage must maintain a tightly controlled balance between cartilage synthesis and degradation (Orth, 1999), which is accompanied by changes in extracellular matrix synthesis and remodeling. The primary components in this process are the matrix metalloproteinases (MMP), a family of zinc-dependent proteases (Bittner et al., 1998), which include collagenases, stromelysins, and gelatinases (Sylvestre et al., 2002).

Several MMP are expressed during endochondral ossification, including MMP-2, 3, 9, 10, 13, and 14 (MT1-MMP; Bord et al., 1997, 1998; Johansson et al., 1997; Zhou et al., 2000). In avians, MMP-2, 3, 9, and 13 (D’Angelo et al., 2000; Tong et al., 2003) have been cloned, but their involvement in the growth plate has not been studied extensively. Matrix metalloproteinase-10 and -14 have not yet been identified. However, another proMMP2 activator, MMP16 (MT3-MMP) was cloned in the chicken and was found to be expressed in the developing limb (Yang et al., 1996).

In this study, we present a detailed survey of the temporal-spatial distribution of the MMP during development of the turkey growth plate, using growth plates from embryonic to juvenile stages. Growth plate-relevant MMP that have been cloned in avian species were chosen for this study to serve as a data source (atlas) for further studies in this subject.

	MATERIALS AND METHODS

Top Abstract INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION LITERATURE CITED

 
Materials
Radio-labeled-UTP (³⁵S 1000 Ci/mmol) was purchased from the Radio-chemical Center (Amersham, Amersham, UK). Digoxigenin dUTP was purchased from Enzo (Mannheim, Germany). Digoxigenin-RNA labeling, BCIP (5-bromo-4-chloro-3-indolyl-phosphate Mix), and nitro blue tetrazolium (NBT) were purchased from Roche (Wiesbaden, Germany).

Birds
All procedures were approved by the Animal Care Welfare Committee of ARO Volcani center. Turkey embryos and chicks (B.U.T. strain) were obtained from a commercial hatchery (Ramit, Hadera, Israel). Eggs were taken from the commercial hatchery and incubated in our laboratory. The embryos were killed on d 11, 14, and 18. Chicks (1 d old) were purchased from a commercial hatchery and raised for up to 7 d under a recommended temperature regimen. Chicks had free access to water and ad libitum access to a commercial diet formulated to meet NRC (1994) recommendations. Chicks were killed on d 3 and 7. The birds were killed by cervical dislocation. Right and left tibias were collected. Sections were taken from the center of the bone.

Preparation of Probes
Probes for in situ hybridization were prepared for chicken collagen types II and X, MMP-2, MMP-3, MMP-9, MMP-13, and MMP-16 using PCR amplification from cDNA of chicken growth plates and primary cultured chondrocytes isolated from the proximal tibial growth plates, with the following primers:

Collagen II (accession number I50176):

Forward: ATATCCACGCCAAACTCCTG,

Reverse: GCTCCCAGAACGTCACCTAC;

Collagen X (accession number M13496):

Forward: CCACCTGGATTCTCCACTGT,

Reverse: TTCAAATCCTGGAAGACCTG;

MMP-2 (accession number U07775):

Forward: TTCCAAGAAAGCCAAAATGG,

Reverse: GCTGGTAGAAGCACACCACA;

MMP-3 (accession number BX950347):

Forward: TCACCCCTCTGAGGTTCATC,

Reverse: AAGCCAGCTACCAATGATGG;

MMP-9 (accession number AF222690):

Forward: ACCGTGCCGTGATAGATGAT,

Reverse: AGCCACCAAGAAGATGCTGT;

MMP-13 (accession number AF070478):

Forward: AGGAGATGCCCATTTTGATG,

Reverse: CAGGATGCGGACAATTCTTT; and

MMP-16 (accession number U66463):

Forward: GACCAAACAAGAGGCAGCTC,

Reverse: GCTTCGCCAAAACCATTGAT.

Probe sizes ranged from 600 to 800 bp. Suitability of the probes for turkey genes was checked by PCR amplifications of the indicated chicken primers, using turkey growth plate and primary cultured tibial growth plate chondrocyte cDNA as a template. The PCR products were ligated into pGEM constructs using the pGEM T Easy kit (Promega, Madison, WI) according to the manufacturer’s protocol to be used as probes for in situ hybridization. Restriction enzymes were used to create sense or antisense probes.

Histological Staining and In-Situ Hybridization of Growth-Plate Sections
Growth plates were fixed overnight [at embryonic d 11 of incubation, all bone was fixed] in 4% paraformaldehyde (Sigma Chemical, St. Louis, MO) in PBS at 4°C. The samples were dehydrated in graded ethanol solutions, cleared in chloroform, embedded in Para-plast, and 5-µm sections were prepared. Tartrate-resistant acid phosphatase (TRAP) staining was performed using a detection kit for acid phosphatase in the presence of tartrate (Sigma Chemical).

Hybridizations were preformed as described by Reich et al. (2005). The sections were deparafinized in xylene, rehydrated through a graded series of ethanol solutions, rinsed in distilled water for 5 min, and incubated in 2x SSC at 55°C for 30 min. The sections were then rinsed in distilled water and treated with proteinase K (10 µg/mL in 0.2 M Tris-HCl, 5 mM EDTA, pH 7.5) for 10 min. After digestion, the slides were rinsed with distilled water, fixed in 10% formaldehyde in PBS, blocked in 0.2% glycine, rinsed in distilled water, rapidly dehydrated through graded ethanol solutions, and air dried for several hours.

The sections were then hybridized with digoxigenin-labeled antisense probes for collagen type II or X, or with ³⁵S-labeled probes (10 ng) for MMP-2, 3, 9, 13, and 16 (Reich et al., 2005). Digoxigenin-labeled probes were detected using a polyclonal antidigoxigenin antibody attached to alkaline phosphatase (ALP; Gentili et al., 1993) that, when it reacts with its substrate (NBT and BCIP), produces a colored precipitate. Endogenous ALP was inhibited with Levamisole (Knopov et al., 1997). The sections were stained with Methyl green (Zymed, San Francisco, CA) and photographed using bright field. The radioactive signal of the ³⁵S-labeled probes was intensified using a photographic emulsion (NTB-2, Eastman Kodak Company, Rochester, NY); the sections were incubated with the emulsion solution for 1 mo, in dark conditions, at room temperature. After developing, the sections were stained with hematoxylin for nuclear staining and photographed using bright or dark fields. In all hybridizations, no signal was observed with sense probes, which were used as controls.

	RESULTS AND DISCUSSION

Top Abstract INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION LITERATURE CITED

 
This study identified and characterized, for the first time, the expression pattern of 5 members of the MMP family in the turkey growth plate at embryonic d 11, 14 and 18 (e11, e14, and e18, respectively) and at 3 and 7 d of age (3d and 7d, respectively), using in-situ hybridization analysis. This technique is qualitative rather than quantitative; the slides shown are representative for each age and gene. The studied MMP were MMP-2, MMP-3, MMP-9, MMP-13, and MMP-16, known for their importance in the process of endochondral ossification (Ortega et al., 2004), and the results are shown in Figures 1 to 5, respectively.

View larger version (69K): [in this window] [in a new window]   Figure 1. Matrix metalloproteinase (MMP)-2 expression in the turkey’s growth plate during development. Turkey growth plates from embryonic (e) days A) 11, B) 14, and C) 18 and at the ages of D) 3 d and E) 7 d were processed as described in Materials and Methods and subjected to in-situ hybridization with 35S-labeled riboprobes of the avian MMP-2. A–E) Whole growth plate (x7.5). F, G) Growth plate at e14 (x40) showing chondrocytes expressing MMP-2 migrating from the perichondrium (Pr) to the proliferative zone (PZ), as well as cells expressing MMP-2 at the perimeters of the blood vessels (BV); no expression was seen in the hypertrophic chondrocytes (HZ). H, I) Growth plate at e18 (x40) showing MMP-2 expression in the proliferative zone and in cells surrounding the blood vessels of the epiphysis (AC). J) Collagen type II expression in the turkey growth plate, a typical marker of the proliferative zone. F, H, J) bright field; A–E, G, I) dark field.

View larger version (129K): [in this window] [in a new window]   Figure 2. Matrix metalloproteinase (MMP)-3 expression in the turkey’s growth plate during development. Turkey growth plates from embryonic (e) days A) 11 and B) 18 and at the ages of C) 3 d and D) 7 d were processed as described in Materials and Methods and subjected to in-situ hybridization with 35S-labeled riboprobes of the avian MMP-3. A–D) Whole growth plate (x7.5). E, F) Growth plate at e11 (x40) showing MMP-3 expression at the front of a blood vessel (BV) located in the primary ossification center (CO) and in hypertrophic chondrocytes (HC) adjacent to the compact bone (CB). G, H) Growth plate at e18 (x40) showing MMP-3 expression in cells lining the blood vessels in the hypertrophic zone (HZ). I, J) Growth plate at e18 (x100) showing MMP-3 expression in hypertrophic chondrocytes adjacent to the compact bone, but not in hypertrophic chondrocytes in the rest of the hypertrophic zone. K, L) Growth plate at 3d (x40) showing MMP-3 expression in cells surrounding the blood vessels penetrating to both the hypertrophic and proliferative zones (PZ) of the growth plate. M) Tartrate-resistant acid phosphatase (TRAP) staining showing osteoclasts at the blood vessel perimeter (x100). E, G, I, K) bright field; A–D, F, H, J, L) dark field.

View larger version (151K): [in this window] [in a new window]   Figure 3. Matrix metalloproteinase (MMP)-9 expression in the turkey’s growth plate during development. Turkey growth plates from embryonic (e) days A) 11 and B) 18 and at the ages of C) 3 and D) 7 d were processed as described in the Materials and Methods and subjected to in-situ hybridization with 35S-labeled riboprobes of the avian MMP-9. A–D) Whole growth plate (x7.5). E, F) Growth plate at e11 (x100) showing MMP-9 expression at the front of a blood vessel (BV) in the primary ossification center, and in the compact bone (CB), bone (B), and hypertrophic chondrocytes (HC). G, H) Growth plate at e18 (x40) showing MMP-9 expression in cells surrounding the blood vessels of the epiphysis (AC) and the proliferative zone (PZ), but not in the chondrocytes themselves. I, J) Growth plate at 3d (x40) showing MMP-9 expression in chondrocytes around blood vessels in the hypertrophic zone (HZ) and in cells surrounding blood vessels in the proliferative zone. K) Collagen type II expression in the turkey’s growth plate, a typical marker of the proliferative zone (x40). L) Collagen type X expression in the turkey’s growth plate, a typical marker of the hypertrophic zone (x40). M) Tartrate-resistant acid phosphatase (TRAP) staining showing osteoclasts at the blood vessel perimeter (x200). E, G, I, K–M) bright field; A–D, F, H, J) dark field.

View larger version (79K): [in this window] [in a new window]   Figure 4. Matrix metalloproteinase (MMP)-13 expression in the turkey’s growth plate during development. Turkey growth plates from embryonic (e) days A) 11 and B) 18 and at the ages of C) 3 and D) 7 d were processed as described in the Materials and Methods and subjected to in-situ hybridization with 35S-labeled riboprobes of the avian MMP-13. A–D) Whole growth plate (x7.5). E, F) Growth plate at e11 (x100) showing MMP-13 expression in hypertrophic chondrocytes (HC). G, H) Growth plate at e18 (x40) showing MMP-13 expression in hypertrophic chondrocytes adjacent to the compact bone (CB) and in cells surrounding the blood vessels (BV) in the hypertrophic zone (HZ). E, G) bright field; A–D, F, H) dark field.

View larger version (88K): [in this window] [in a new window]   Figure 5. Matrix metalloproteinase (MMP)-16 expression in the turkey’s growth plate during development. Turkey growth plates from embryonic (e) days A) 11, B) 14 and C) 18 and at the ages of D) 3 and E) 7 d were processed as described in Materials and Methods and subjected to in-situ hybridization with 35S-labeled riboprobes of the avian MMP-16. A–E) Whole growth plate (x7.5). F, G) Growth plate at e11 (x40) showing MMP-16 expression in the epiphysis (AC). H, I) Growth plate at e11 (x40) showing MMP-16 expression in the bone (B), and no expression in the hypertrophic chondrocytes (HC). J, K) Growth plate at e14 (x40) showing MMP-16 expression in the epiphysis and in cells surrounding its blood vessels and in the reserve zone (RZ #0), no expression in the proliferative zone (PZ). L, M) Growth plate at 3d (x40) showing MMP-16 expression in the reserve zone and in cells surrounding the blood vessel (BV) in the hypertrophic zone (HZ) but no expression in the hypertrophic chondrocytes. F, H, J, L) bright field; A–E, G, I, K, M) dark field.

Matrix metalloproteinase-3 (stromelysin-1) has broad substrate specificity, including proteoglycans, collagen types III, IV, and V, casein, and fibronectin. Besides digesting extracellular matrix components, MMP-3 activates a number of proMMP, for example proMMP-1 and proMMP-9 (DeClerck and Laug, 1996). At e11, MMP-3 is expressed at the primary ossification center, in front of the blood vessels and in hypertrophic chondrocytes adjacent to the compact bone (Figure 2A, E, F). From e18 on, when the growth plate is in its definitive location, MMP-3 is expressed in cells surrounding the blood vessels penetrating the growth plate, in the hypertrophic and proliferative zones (Figure 2B, C, D, G, H, K, L), as well as in hypertrophic chondrocytes, mainly those adjacent to the compact bone (Figure 2I, J) and in cells surrounding the blood vessels in the epiphysis and bone (Figure 2B, C, D). Expression of MMP-3 in hypertrophic chondrocytes is probably associated with its ability to degrade proteoglycans (it is the most potent proteoglycanase among all MMP), and it is therefore important for endochondral ossification (Armstrong et al., 2002; Visse and Nagase, 2003). In human long bones, MMP-3 is expressed in hypertrophic chondrocytes and osteoblasts, but not in osteoclasts or endothelial cells (Chin et al., 1985). Our findings show the expression of this gene in cells lining the inner walls of the blood vessels, indicating that those cells could be osteoclasts or endothelial cells. Staining with TRAP, which identifies osteoclasts, was found in the same locations (Figure 2M), suggesting that in turkey osteoclasts express MMP-3.

Matrix metalloproteinase-9 (gelatinase B) is a key regulator of growth-plate angiogenesis and apoptosis of hypertrophic chondrocytes (Vu et al., 1998). Its molecular mode of action includes releasing vascular endothelial growth factor or other growth factors from the matrix (Engsig et al., 2000; Sternlicht and Werb, 2001) and degradation of type II collagen. At e11, MMP-9 is expressed by cells in front of the blood vessels in the primary ossification center (Figure 3A,E,F). At e18, MMP-9 is expressed in cells surrounding the blood vessels in the bone and in the proliferative (Figure 3G,H), and hypertrophic zones of the growth plate, as well as in the epiphysis (Figure 3B). At 3d, MMP-9 is expressed in hypertrophic chondrocytes adjacent to the compact bone (Figure 3C) and surrounding the blood vessels, but not in the rest of the hypertrophic zone (Figure 3I, J). The cells surrounding the blood vessels in the proliferative zone also express MMP-9, but in contrast to the hypertrophic zone, the chondrocytes around these vessels do not express this gene (Figure 3I, J). Using the chondrocytic markers, collagen type II (Figure 3K) and collagen type X (Figure 3I), we distinguish between the proliferative and hypertrophic zones, respectively. Expression of MMP-9 is also seen around the blood vessels in the epiphysis (Figure 3C). At 7d, the expression of the gene is similar to that seen at 3d. The trabecular bone is highly vascularized at this stage, and MMP-9 expression is seen in cells surrounding those blood vessels (Figure 3D). Staining with TRAP showed osteoclasts located at the perimeter of the blood vessels (Figure 3M), suggesting that in turkey, as in other species, osteoclasts express MMP-9 (Tong et al., 2003). Based on the literature, we suggest that MMP-9 is expressed by endothelial cells as well (Takahara et al., 2004). Expression of MMP-9 may be associated with MMP-3 expression because MMP-3 is the primary activator of proMMP-9 (O’Connell et al., 1994). We show that MMP-9, like MMP-3, is expressed at 3d adjacent to the compact bone, and it is only at 7d that its expression spreads to the hypertrophic zone and the compact bone.

Matrix metalloproteinase-13 (collagenase-3) plays a crucial role in bone formation and remodeling. This is manifested by the human mutation in MMP-13 that causes the Missouri variant of spondyloepimetaphyseal dysplasia with abnormalities in the development and growth of endochondral skeletal elements (Kennedy et al., 2005).

Matrix metalloproteinase-13 substrates include collagen types I and II as well as aggrecan, and it can synergize with MMP-9 in their degradation (Engsig et al., 2000; Stickens et al., 2004). At e11, MMP-13 is expressed around the blood vessels of the primary ossification center and in the hypertrophic chondrocytes (Figure 4A). From e18 on, MMP-13 is expressed in cells surrounding the blood vessels of the epiphysis, the hypertrophic zone and the bone, as well as in hypertrophic chondrocytes, with very high expression in those adjacent to the compact bone (Figure 4B, C, D, G, H). At 7d, the trabecular bone is highly vascularized with prominent MMP-13 expression around the blood vessels (Figure 4D). Matrix metalloproteinase-2 is a proMMP-13 activator (Chakraborti et al., 2003); thus there is a great biological importance for the colocalization of those 2 genes. In this study, we found that MMP-2 and MMP-13 colocalize in several places, including the primary ossification center at e11, in cells surrounding the blood vessels of the epiphysis, and in the trabecular bone. Matrix metalloproteinase-2 is expressed in the compact bone and might activate proMMP-13 from the hypertrophic chondrocytes adjacent to it. D’Angelo et al. (2000) showed that in the chicken sternum, MMP-13 mRNA is upregulated in the prehypertrophic chondrocytes, but its activity is upregulated only in the late hypertrophic chondrocytes, where MMP-2 levels are upregulated. In the turkey growth plate, MMP-2 is not expressed in late hypertrophic chondrocytes. It is possible that in this zone proMMP-13 is activated by other MMP, for example MMP-3 (Chakraborti et al., 2003), which is expressed in the hypertrophic zone at this age, or MMP-14 (Knauper et al., 1997), which has not yet been cloned in avian species. Further research, using for example, in-situ zymography, could answer these questions.

Matrix metalloproteinase-16 (MT3-MMP) is a membrane-type MMP that is associated with proMMP-2 activation (Hernandez-Barrantes et al., 2002). Although MMP-14 (MT1-MMP), which also activates proMMP-2 and has been demonstrated to be important during ossification (Holmbeck et al., 1999), has not yet been cloned in avian species, we thought it would be informative to investigate the expression pattern of this other MT-MMP. To our knowledge, besides humans (Haeusler et al., 2005), this is the only species’ growth plate in which MMP-16 expression is demonstrated. At e11, MMP-16 is expressed in the cells of the epiphysis (Figure 5A,F,G) and in the bone at the primary ossification center (Figure 5A, H, I). From e14 on, MMP-16 is expressed in the epiphysis and in cells surrounding its blood vessels, in the reserve zone of the growth plate (Figure 5J, K, L, M), in cells surrounding the blood vessels penetrating the hypertrophic zone but not in hypertrophic chondrocytes (Figure 5L, M), and in the compact bone (Figure 5B, C, D, E). In cells surrounding the blood vessels and in the compact bone, MMP-16 is colocalizes with MMP-2, suggesting its role in proMMP-2 activation in those sites. At 7d, MMP-16 expression is observed in the trabecular bone (Figure 5E). It should be noted that with age, the intensity of this expression in the epiphysis declines and the reserve zone narrows.

Our findings demonstrate, for the first time, the MMP expression in the endochondral ossification process during turkey development. We were unable to show protein location because there are no turkey antibodies available and no cross-reactivity with commercial mammalian antibodies. However, although MMP are secreted as zymogens, a cascade of mutual activation exists in which an active MMP can activate other proMMP, and therefore gene expression localization can give us good prediction for protein activity. The MMP play a crucial role in matrix remodeling, cartilage turnover, and angiogenesis, thus allowing blood invasion into the growth plate and cartilage replacement by bone tissue. We show that MMP-2, MMP-3, MMP-9, MMP-13, and MMP-16 are all expressed during bone development in turkey and that their expression patterns change throughout the different stages.

	Footnotes

 
¹ This work was supported by Research Grant award No. IS-3403-03 from BARD, the United States-Israel Binational Agricultural Research and Development Fund, and by a Poultry Board of Israel grant.

² Parts of this research were done during researcher employment in the ARO Volcani Center.

³ Corresponding author: ornanme{at}agri.huji.ac.il

Received for publication October 29, 2006. Accepted for publication February 4, 2007.

	LITERATURE CITED

Top Abstract INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION LITERATURE CITED

 


Aimes, R. T., and J. P. Quigley. 1995. Matrix metalloproteinase-2 is an interstitial collagenase. Inhibitor-free enzyme catalyzes the cleavage of collagen fibrils and soluble native type I collagen generating the specific - and -length fragments. J. Biol. Chem. 270:5872–5876.

Armstrong, A. L., 0H. J. Barrach, and M. G. Ehrlich. 2002. Identification of the metalloproteinase stromelysin in the physis. J. Orthop. Res. 20:289–294.[CrossRef][Medline]

Bittner, K., P. Vischer, P. Bartholmes, and P. Bruckner. 1998. Role of the subchondral vascular system in endochondral ossification: Endothelial cells specifically derepress late differentiation in resting chondrocytes in vitro. Exp. Cell Res. 238:491–497.[CrossRef][Medline]

Bord, S., A. Horner, R. M. Hembry, and J. E. Compston. 1998. Stromelysin-1 (MMP-3) and stromelysin-2 (MMP-10) expression in developing human bone: Potential roles in skeletal development. Bone 23:7–12.[Medline]

Bord, S., A. Horner, R. M. Hembry, J. J. Reynolds, and J. E. Compston. 1997. Distribution of matrix metalloproteinases and their inhibitor, TIMP-1, in developing human osteophytic bone. J. Anat. 191:39–48.[CrossRef][Medline]

Chakraborti, S., M. Mandal, S. Das, A. Mandal, and T. Chakraborti. 2003. Regulation of matrix metalloproteinases: An overview. Mol. Cell. Biochem. 253:269–285.[CrossRef][Medline]

Chin, J. R., G. Murphy, and Z. Werb. 1985. Stromelysin, a connective tissue-degrading metalloendopeptidase secreted by stimulated rabbit synovial fibroblasts in parallel with collagenase. Biosynthesis, isolation, characterization, and substrates. J. Biol. Chem. 260:12367–12376.[Abstract/Free Full Text]

Colnot, C. I., and J. A. Helms. 2001. A molecular analysis of matrix remodeling and angiogenesis during long bone development. Mech. Dev. 100:245–250.[CrossRef][Medline]

D’Angelo, M., Z. Yan, M. Nooreyazdan, M. Pacifici, D. S. Sarment, P. C. Billings, and P. S. Leboy. 2000. MMP-13 is induced during chondrocyte hypertrophy. J. Cell. Biochem. 77:678–693.[CrossRef][Medline]

DeClerck, Y. A., and W. E. Laug. 1996. Cooperation between matrix metalloproteinases and the plasminogen activator-plasmin system in tumor progression. Enzyme Protein 49:72–84.[Medline]

DeLise, A. M., L. Fischer, and R. S. Tuan. 2000. Cellular interactions and signaling in cartilage development. Osteoarthr. Cartil. 8:309–334.[CrossRef][Medline]

Engsig, M. T., Q. J. Chen, T. H. Vu, A. C. Pedersen, B. Therkidsen, L. R. Lund, K. Henriksen, T. Lenhard, N. T. Foged, Z. Werb, and J. M. Delaisse. 2000. Matrix metalloproteinase 9 and vascular endothelial growth factor are essential for osteoclast recruitment into developing long bones. J. Cell Biol. 151:879–889.[Abstract/Free Full Text]

Gentili, C., P. Bianco, M. Neri, M. Malpeli, G. Campanile, P. Castagnola, R. Cancedda, and F. D. Cancedda. 1993. Cell proliferation, extracellular matrix mineralization, and ovotransferrin transient expression during in vitro differentiation of chick hypertrophic chondrocytes into osteoblast-like cells. J. Cell Biol. 122:703–712.[Abstract/Free Full Text]

Gerber, H. P., and N. Ferrara. 2000. Angiogenesis and bone growth. Trends Cardiovasc. Med. 10:223–228.[CrossRef][Medline]

Haeusler, G., I. Walter, M. Helmreich, and M. Egerbacher. 2005. Localization of matrix metalloproteinases, (MMPS) their tissue inhibitors, and vascular endothelial growth factor (VEGF) in growth plates of children and adolescents indicates a role for MMPS in human postnatal growth and skeletal maturation. Calcif. Tissue Int. 76:326–335.[CrossRef][Medline]

Hatori, K., Y. Sasano, I. Takahashi, S. Kamakura, M. Kagayama, and K. Sasaki. 2004. Osteoblasts and osteocytes express MMP2 and -8 and TIMP1, -2, and -3 along with extracellular matrix molecules during appositional bone formation. Anat. Rec. A Discov. Mol. Cell. Evol. Biol. 277:262–271.[Medline]

Hernandez-Barrantes, S., M. Bernardo, M. Toth, and R. Fridman. 2002. Regulation of membrane type-matrix metalloproteinases. Semin. Cancer Biol. 12:131–138.[CrossRef][Medline]

Holmbeck, K., P. Bianco, J. Caterina, S. Yamada, M. Kromer, S. A. Kuznetsov, M. Mankani, P. G. Robey, A. R. Poole, I. Pidoux, J. M. Ward, and H. Birkedal-Hansen. 1999. MT1-MMP-deficient mice develop dwarfism, osteopenia, arthritis, and connective tissue disease due to inadequate collagen turnover. Cell 99:81–92.[CrossRef][Medline]

Itoh, T., M. Tanioka, H. Yoshida, T. Yoshioka, H. Nishimoto, and S. Itohara. 1998. Reduced angiogenesis and tumor progression in gelatinase A-deficient mice. Cancer Res. 58:1048–1051.[Abstract/Free Full Text]

Johansson, N., U. Saarialho-Kere, K. Airola, R. Herva, L. Nissinen, J. Westermarck, E. Vuorio, J. Heino, and V. M. Kahari. 1997. Collagenase-3 (MMP-13) is expressed by hypertrophic chondrocytes, periosteal cells, and osteoblasts during human fetal bone development. Dev. Dyn. 208:387–397.[CrossRef][Medline]

Kawashima-Ohya, Y., H. Satakeda, Y. Kuruta, T. Kawamoto, W. Yan, Y. Akagawa, T. Hayakawa, M. Noshiro, Y. Okada, S. Nakamura, and Y. Kato. 1998. Effects of parathyroid hormone (pth) and pth-related peptide on expressions of matrix metalloproteinase-2, -3, and -9 in growth plate chondrocyte cultures. Endocrinology 139:2120–2127.[Abstract/Free Full Text]

Kennedy, A. M., M. Inada, S. M. Krane, P. T. Christie, B. Harding, C. Lopez-Otin, L. M. Sanchez, A. A. Pannett, A. Dearlove, C. Hartley, M. H. Byrne, A. A. Reed, M. A. Nesbit, M. P. Whyte, and R. V. Thakker. 2005. MMP13 mutation causes spondyloepimetaphyseal dysplasia, Missouri type (SEMD(MO). J. Clin. Invest. 115:2832–2842.[CrossRef][Medline]

Knauper, V., B. Smith, C. Lopez-Otin, and G. Murphy. 1997. Activation of progelatinase B (PROMMP-9) by active collagenase-3 (MMP-13). Eur. J. Biochem. 248:369–373.[Medline]

Knopov, V., D. Hadash, S. Hurwitz, R. M. Leach, and M. Pines. 1997. Gene expression during cartilage differentiation in turkey tibial dyschondroplasia, evaluated by in situ hybridization. Avian Dis. 41:62–72.[CrossRef][Medline]

Kume, K., K. Satomura, S. Nishisho, E. Kitaoka, K. Yamanouchi, S. Tobiume, and M. Nagayama. 2002. Potential role of leptin in endochondral ossification. J. Histochem. Cytochem. 50:159–169.[Abstract/Free Full Text]

NRC. 1994. Nutrient Requirements of Poultry. 9th ed. Natl. Acad. Press, Washington, DC.

O’Connell, J. P., F. Willenbrock, A. J. Docherty, D. Eaton, and G. Murphy. 1994. Analysis of the role of the COOH-terminal domain in the activation, proteolytic activity, and tissue inhibitor of metalloproteinase interactions of gelatinase B. J. Biol. Chem. 269:14967–14973.[Abstract/Free Full Text]

Ortega, N., D. J. Behonick, and Z. Werb. 2004. Matrix remodeling during endochondral ossification. Trends Cell Biol. 14:86–93.[CrossRef][Medline]

Orth, M. W. 1999. The regulation of growth plate cartilage turnover. J. Anim. Sci. 77(Suppl 2):183–189.[Abstract/Free Full Text]

Reich, A., N. Jaffe, A. Tong, I. Lavelin, O. Genina, M. Pines, D. Sklan, A. Nussinovitch, and E. Monsonego-Ornan. 2005. Weight loading young chicks inhibits bone elongation and promotes growth plate ossification and vascularization. J. Appl. Physiol. 98:2381–2389.[Abstract/Free Full Text]

Rundhaug, J. E. 2005. Matrix metalloproteinases and angiogenesis. J. Cell. Mol. Med. 9:267–285.[Medline]

Sternlicht, M. D., and Z. Werb. 2001. How matrix metalloproteinases regulate cell behavior. Annu. Rev. Cell Dev. Biol. 17:463–516.[CrossRef][Medline]

Stickens, D., D. J. Behonick, N. Ortega, B. Heyer, B. Hartenstein, Y. Yu, A. J. Fosang, M. Schorpp-Kistner, P. Angel, and Z. Werb. 2004. Altered endochondral bone development in matrix metalloproteinase 13-deficient mice. Development 131:5883–5895.[Abstract/Free Full Text]

Sylvestre, M. N., D. Balcerzak, C. Feidt, V. E. Baracos, and J. Brun Bellut. 2002. Elevated rate of collagen solubilization and postmortem degradation in muscles of lambs with high growth rates: Possible relationship with activity of matrix metalloproteinases. J. Anim. Sci. 80:1871–1878.[Abstract/Free Full Text]

Takahara, M., T. Naruse, M. Takagi, H. Orui, and T. Ogino. 2004. Matrix metalloproteinase-9 expression, tartrate-resistant acid phosphatase activity, and DNA fragmentation in vascular and cellular invasion into cartilage preceding primary endochondral ossification in long bones. J. Orthop. Res. 22:1050–1057.[CrossRef][Medline]

Tong, A., A. Reich, O. Genin, M. Pines, and E. Monsonego-Ornan. 2003. Expression of chicken 75-kDa gelatinase B-like enzyme in perivascular chondrocytes suggests its role in vascularization of the growth plate. J. Bone Miner. Res. 18:1443–1452.[CrossRef][Medline]

Tsumaki, N., and H. Yoshikawa. 2005. The role of bone morphogenetic proteins in endochondral bone formation. Cytokine Growth Factor Rev. 16:279–285.[CrossRef][Medline]

Visse, R., and H. Nagase. 2003. Matrix metalloproteinases and tissue inhibitors of metalloproteinases: Structure, function, and biochemistry. Circ. Res. 92:827–839.[Abstract/Free Full Text]

Vu, T. H., J. M. Shipley, G. Bergers, J. E. Berger, J. A. Helms, D. Hanahan, S. D. Shapiro, R. M. Senior, and Z. Werb. 1998. MMP-9/gelatinase B is a key regulator of growth plate angiogenesis and apoptosis of hypertrophic chondrocytes. Cell 93:411–422.[CrossRef][Medline]

Yang, M., K. Hayashi, M. Hayashi, J. T. Fujii, and M. Kurkinen. 1996. Cloning and developmental expression of a membrane-type matrix metalloproteinase from chicken. J. Biol. Chem. 271:25548–25554.[Abstract/Free Full Text]

Zhou, Z., S. S. Apte, R. Soininen, R. Cao, G. Y. Baaklini, R. W. Rauser, J. Wang, Y. Cao, and K. Tryggvason. 2000. Impaired endochondral ossification and angiogenesis in mice deficient in membrane-type matrix metalloproteinase I. Proc. Natl. Acad. Sci. USA 97:4052–4057.[Abstract/Free Full Text]

This article has been cited by other articles:

				M. Hasky-Negev, S. Simsa, A. Tong, O. Genina, and E. Monsonego Ornan Expression of matrix metalloproteinases during vascularization and ossification of normal and impaired avian growth plate J Anim Sci, June 1, 2008; 86(6): 1306 - 1315. [Abstract] [Full Text] [PDF]

				S. Simsa, A. Hasdai, H. Dan, and E. M. Ornan Induction of Tibial Dyschondroplasia in Turkeys by Tetramethylthiuram Disulfide (Thiram) Poult. Sci., August 1, 2007; 86(8): 1766 - 1771. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: jas.2006-711v1 85/6/1393    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Simsa, S. Articles by Ornan, E. M. Search for Related Content PubMed PubMed Citation Articles by Simsa, S. Articles by Ornan, E. M.