| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ANIMAL GENETICS |
* Key Laboratory of Agricultural Animal Genetics, Breeding, and Reproduction, Ministry of Education, Huazhong Agricultural University, Wuhan 430070, China; and
and
Department of Bioengineering, College of Animal Sciences, Southwest University, Chongqing 400716, China
 |
Abstract |
|---|
 Top Abstract INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Key Words: imprinting • paternal expression gene 10 • pig • pleomorphic adenoma gene-like I
|
INTRODUCTION |
|---|
|
TopAbstractINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
). In mammals in particular, imprinted genes have an important function in the regulation of fetal growth, development, function of the placenta, and postnatal behavior (Reik et al., 2003). However, most imprinted genes have been identified in humans and mice. There are only a small number of imprinted genes identified in livestock. At present, only 10 imprinted genes have been identified in sheep (GTL2, DLK1, DAT, PEG11, antiPEG11, MEG8, MEST, IGF2, H19, and IGF2R), 8 in cattle (IGF2R, XIST, IGF2, GTL2, NESP55, H19, PEG3, and NNAT), and 3 in pigs (IGF2, IGF2R, and IGF2-AS; University of Otago, 2006).
The IGF2 gene, which was identified as the first imprinted gene in pigs, has important effects on porcine growth, meat quality, and carcass composition, especially fat deposition (Nezer et al., 1999; Estelle et al., 2005). Therefore, identification and characterization of more imprinted genes to improve porcine production traits is of interest. Moreover, identifying additional imprinted genes in pigs is useful for comparative genomic analysis of genomic imprinting across species.
The porcine pleomorphic adenoma gene-like I (PLAGL1) gene, which is located on human chromosome 6 and mouse chromosome 10, regulates cell growth. In humans and mice, this gene is paternally expressed in all tissues except mouse liver, where it has biallelic expression (Kamiya et al., 2000; Piras et al., 2000). The paternal expression gene 10 (PEG10) gene located on human chromosome 7q21–q31 and proximal to the centromere of mouse chromosome 6 is maternally imprinted in the 2 species (Okita et al., 2003; Ono et al., 2003). The imprinting status of the PLAGL1 and PEG10 genes in pigs has not been reported previously.
In this study, we used the polymorphism-based approach to analyze the imprinting status of the porcine PLAGL1 and PEG10 genes.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Tissue Samples and DNA Preparation
Skeletal muscle tissue from an adult Large White and an adult Meishan pig was obtained to prepare complementary DNA (cDNA) and search for SNP. Genomic DNA was isolated from the white blood cells of 16 F1 hybrid pigs from Large White boars and Meishan sows and their fathers according to the standard phenol-chloroform method. Tissues (heart, liver, spleen, lung, kidney, stomach, small intestine, skeletal muscle, fat, uterus, and ovary) from 4 heterozygous pigs (based on SNP) of the 16 F1 hybrid pigs were collected for imprinting analysis.
RNA Isolation and cDNA Synthesis
Total RNA from all tissues collected was isolated with Trizol reagent (Invitrogen, Carlsbad, CA) according to the instructions of the manufacturer. First-strand cDNA was synthesized from 2 µg of total RNA treated with DNase I (TaKaRa, Tokyo, Japan) in a 20-µL reaction volume containing 5 µM oligo(dT)16 primer, 1 x M-MLV first-strand buffer, 40 U of M-MLV reverse transcription (RT), 1 mM of each dNTP, and 8 U of RNase inhibitor (Promega, Madison, WI) at 42°C for 60 min.
PCR of DNA and cDNA
The human PLAGL1 (GenBank accession number NM_006718) and PEG10 (GenBank accession number XM_496907) cDNA sequences were used to search for available expressed sequence tags (EST) in the "EST-others" database using BLAST (http://www.ncbi.nlm.-nih.gov/BLAST/). Pig EST that shared more than 85% sequence identity with the human cDNA sequences were assembled into EST contigs. All primers were designed from the consensus sequence of EST contigs (Table 1). Polymerase chain reactions were performed in a 25-µL volume containing 25 ng of porcine cDNA or 50 ng of DNA, 1x PCR buffer, 0.2 µM of each primer, 150 µM of each dNTP, 1.5 mM MgCl2, and 1 U of Taq DNA polymerase (Promega). The PCR conditions were as follows: 94°C for 4 min, 35 cycles of 94°C for 45 s, touchdown annealing from 62°C to 54°C for 50 s (–2°C per cycle), 72°C for 1 min, and a final extension at 72°C for 7 min. Primers (forward: ACCACAGTCCATGCCATCAC and reverse: TCCACCACCCTGTTGCTGTA), which amplify a fragment spanning intron 8 of the GAPDH gene, were applied to exclude the possibility of DNA contamination during all RT-PCR reactions.
|
The RT-PCR products were purified with the Wizard prep PCR purification system (Promega), cloned with pMD18-T easy vector (TaKaRa), and sequenced commercially (AuGCT, Beijing, China). Sequences of Large White and Meishan pigs were aligned with DNAStar software (DNAStar Inc., Madison, WI) to search for SNP.
RFLP of PCR and RT-PCR Products
Eight microliters of PCR or RT-PCR products amplified by primer pairs PL2F/PL2R and PE4F/PE4R (Table 1
) were incubated at 65°C for 4 h with 3 U of the restriction enzyme TaqI (TaKaRa) and 1 µL attached 10 x Taq 1 Basal Buffer, then electrophoresed at 150 V on a 1.5% (wt/vol) agarose gel.
|
RESULTS |
|---|
|
TopAbstractINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Primer pairs PL1F/PL1R, PL2F/PL2R, and PL3F/ PL3R for PLAGL1 were used to amplify cDNA made from adult Large White and Meishan skeletal muscle tissues. The 3 primer pairs amplified a 2,238-bp fragment that contained the complete open reading frame encoding 463 AA. Primer pairs PE1F/PE1R, PE2F/ PE2R, PE3F/PE3R, and PE4F/PE4R of the PEG10 gene were used to amplify a total of 6,327 bp containing a 1,105-bp open reading frame and 5,222-bp 3' untranslated region. Both of the cDNA sequences were deposited in the GenBank database (accession numbers DQ288899 and DQ323403). Comparison of the Large White and Meishan sequences revealed a C-T (Large White-Meishan) mutation at position 1,428 (DQ288899) of PLAGL1 and another C-T (Large White-Meishan) mutation at position 5,009 (DQ323403) of the PEG10 gene. The PLAGL1 SNP was a synonymous change in the coding region, and the PEG10 SNP was in the 3' untranslated region. The SNP in the PLAGL1 and PEG10 genes were named PL-SNP and PE-SNP, respectively.
Screening for Heterozygous Individuals
The PLAGL1 SNP and PE-SNP were at positions 448 and 147 of the amplicons produced by primer pairs PL2F/PL2R and PE4F/PE4R, respectively. Both of the SNP could be detected using the restriction enzyme TaqI. Allele T is 706 bp and allele C is 258 and 448 bp for PL-SNP, and allele T is 899 bp and allele C is 498 and 401 bp for PE-SNP. Amplifications of primer pairs PL2F/PL2R and PE4F/PE4R were conducted with genomic DNA from 16 F1 Large White-Meishan hybrid pigs, and the PCR products were digested by TaqI. Results of PCR-TaqI-RFLP indicated that 4 pigs were heterozygous at both PL-SNP and PE-SNP (data not shown).
Imprinting Analysis of PLAGL1 Gene
Reverse transcription PCR of heart, liver, spleen, lung, kidney, stomach, small intestine skeletal muscle, fat, uterus, and ovary from the 4 pigs with primers PL2F/PL2R indicated that the PLAGL1 gene was expressed in all the examined tissues. Restriction fragment length polymorphism analysis of the RT-PCR products showed that the paternally inherited C allele was preferentially expressed in the 44 tissues from the 4 heterozygous pigs (Figure 1). The 4 heterozygous pigs had the same expression patterns.
|
Primer pair PE4F/PE4R was used to amplify cDNA from the same tissues mentioned above as well as genomic DNA from their fathers. The RT-PCR products were digested by TaqI. Reverse transcription-PCR-RFLP analysis indicated that the paternal C allele of the PEG10 gene was preferentially expressed in all the tissues (Figure 2). There was no difference in the imprinting status of the gene in any of the examined tissues from the 4 pigs.
|
|
DISCUSSION |
|---|
|
TopAbstractINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Sequence analysis showed that the porcine PLAGL1 gene shared 90 and 83% identity in nucleotide sequences and 91 and 68% identity in AA sequences compared with human and mouse homologs, respectively. The high identity in nucleotides and AA between human and pigs showed that they may have similar biological function. The PLAGL1 protein, which promotes apoptosis and cell cycle arrest, plays an important role in the control of cell fate during neurogenesis, chondrogenesis, and myogenesis (Hoffmann et al., 2003; Valente et al., 2005). Paternal duplication of PLAGL1 causes transient neonatal diabetes mellitus, which presents with intrauterine growth retardation (Gardner et al., 1999; Ma et al., 2004). These observations suggest that PLAGL1 is a candidate gene that may be responsible for fetal growth retardation.
The deduced AA sequence (according to DQ323403) of the porcine PEG10 gene indicated that it had homology to the gag and pol proteins of some vertebrate retrotransposons, which supports the conclusion that PEG10 was derived from a retrotransposon that was previously integrated into the mammalian genome (Ono et al., 2001). Generally, integration of a retrotransposon causes imprinted expression of nearby endogenous genes, but PEG10 is the first possible retrotransposable element that has itself become imprinted following its integration in the human genome (Duhl et al., 1994; Morgan et al., 1999). Further analysis of PEG10 imprinting in pigs may provide important knowledge of the processes associated with genomic imprinting and its evolutionary origin in mammals. The PLAGL1 and PEG10 genes are also both maternally imprinted in pigs similar to their homologs in human and mouse, which indicates the conservation of genomic imprinting across species.
Exogenous expression of the PEG10 protein confers oncogenic activity, and overexpression of the protein decreases cell death mediated by SIAH1, which is a mediator of apoptosis (Okabe et al., 2003). The PEG10 knockout mice showed early embryonic lethality owing to defects in the placenta (Ono et al., 2006). Li et al. (2006) reported that knockdown of PEG10 inhibits the proliferation of Panc1, HepG2, and Hep3B cells and deduced that PEG10 is a c-MYC target gene in cancer cells. We may presume that the PEG10 gene could promote fetal growth. According to the conflict hypothesis (Moore and Haig, 1991), paternally expressed genes are predicted to promote fetal growth, whereas maternally expressed genes are predicted to inhibit embryonic growth. Although the imprinting status of the 2 genes was not studied in fetal tissues in our study, because of the conservation of genomic imprinting in different developmental phases and the imprinting status of PEG10 in human and mouse embryos, we could assume that the imprinting status of the PEG10 gene fits the conflict hypothesis. To confirm the conservation of genomic imprinting in different developmental phases and the accordance of the imprinting status of the 2 genes with the conflict hypothesis, the imprinting status of PLAGL1 and PEG10 in porcine fetal tissues needs to be investigated in future studies.
|
Footnotes |
|---|
2 Corresponding author: 030860005{at}webmail.hzau.edu.cn
Received for publication April 30, 2006. Accepted for publication December 13, 2006.
|
LITERATURE CITED |
|---|
|
TopAbstractINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
This article has been cited by other articles:
|
|
 |
|
  S. R. Bischoff, S. Tsai, N. Hardison, A. A. Motsinger-Reif, B. A. Freking, D. Nonneman, G. Rohrer, and J. A. Piedrahita Characterization of Conserved and Nonconserved Imprinted Genes in Swine Biol Reprod, November 1, 2009; 81(5): 906 - 920. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. B. Clark, M. Janicke, U. Gottesbuhren, T. Kleffmann, M. Legge, E. S. Poole, and W. P. Tate Mammalian Gene PEG10 Expresses Two Reading Frames by High Efficiency 1 Frameshifting in Embryonic-associated Tissues J. Biol. Chem., December 28, 2007; 282(52): 37359 - 37369. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
