J. Anim Sci.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J. Anim Sci. 2007. 85:886-890. doi:10.2527/jas.2006-278
© 2007 American Society of Animal Science

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jas.2006-278v1
85/4/886    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, F. W.
Right arrow Articles by Lei, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, F. W.
Right arrow Articles by Lei, M. G.

ANIMAL GENETICS

Imprinted status of pleomorphic adenoma gene-like I and paternal expression gene 10 genes in pigs1

F. W. Zhang*, H. C. Cheng*, C. D. Jiang{dagger}, C. Y. Deng*,2, Y. Z. Xiong*, F. E. Li* and M. G. Lei*

* Key Laboratory of Agricultural Animal Genetics, Breeding, and Reproduction, Ministry of Education, Huazhong Agricultural University, Wuhan 430070, China; and and {dagger} Department of Bioengineering, College of Animal Sciences, Southwest University, Chongqing 400716, China


    Abstract
 Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Genomic imprinting is theorized to exist in all placental mammals and some marsupials. Imprinted genes play important roles in the regulation of fetal growth, development, and postnatal behavior, but the study of imprinted genes has been limited in livestock. In this study, the polymorphism-based approach was used to detect the expression patterns of the porcine pleomorphic adenoma gene-like I (PLAGL1) and paternal expression gene 10 (PEG10) genes. Single nucleotide polymorphisms in the exons were detected between the Meishan and Large White breeds in the PLAGL1 and PEG10 genes. The polymorphisms were used to determine the monoallelic or biallelic expression with reverse transcription-PCR-RFLP in 44 tissues from 4 heterozygous pigs (based on SNP). Imprinting analysis indicated that the PLAGL1 and PEG10 genes were both paternally expressed in all tissues tested (heart, liver, spleen, lung, kidney, stomach, small intestine, skeletal muscle, fat, uterus, and ovary). Our study showed that the method of identifying polymorphic transcripts with reverse transcription-PCR-RFLP may be beneficial for detecting the imprinting status of some candidate imprinted genes.

Key Words: imprinting • paternal expression gene 10 • pig • pleomorphic adenoma gene-like I


    INTRODUCTION
 Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Imprinted genes are preferentially expressed from either the maternally inherited or the paternally inherited alleles (Ruvinsky, 1999Go). In mammals in particular, imprinted genes have an important function in the regulation of fetal growth, development, function of the placenta, and postnatal behavior (Reik et al., 2003Go). However, most imprinted genes have been identified in humans and mice. There are only a small number of imprinted genes identified in livestock. At present, only 10 imprinted genes have been identified in sheep (GTL2, DLK1, DAT, PEG11, antiPEG11, MEG8, MEST, IGF2, H19, and IGF2R), 8 in cattle (IGF2R, XIST, IGF2, GTL2, NESP55, H19, PEG3, and NNAT), and 3 in pigs (IGF2, IGF2R, and IGF2-AS; University of Otago, 2006Go).

The IGF2 gene, which was identified as the first imprinted gene in pigs, has important effects on porcine growth, meat quality, and carcass composition, especially fat deposition (Nezer et al., 1999Go; Estelle et al., 2005Go). Therefore, identification and characterization of more imprinted genes to improve porcine production traits is of interest. Moreover, identifying additional imprinted genes in pigs is useful for comparative genomic analysis of genomic imprinting across species.

The porcine pleomorphic adenoma gene-like I (PLAGL1) gene, which is located on human chromosome 6 and mouse chromosome 10, regulates cell growth. In humans and mice, this gene is paternally expressed in all tissues except mouse liver, where it has biallelic expression (Kamiya et al., 2000Go; Piras et al., 2000Go). The paternal expression gene 10 (PEG10) gene located on human chromosome 7q21–q31 and proximal to the centromere of mouse chromosome 6 is maternally imprinted in the 2 species (Okita et al., 2003Go; Ono et al., 2003Go). The imprinting status of the PLAGL1 and PEG10 genes in pigs has not been reported previously.

In this study, we used the polymorphism-based approach to analyze the imprinting status of the porcine PLAGL1 and PEG10 genes.


    MATERIALS AND METHODS
 Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
All procedures involving animals were approved by the Animal Care and Use Committee of Huazhong Agricultural University. All animals used in this study were derived from the pig experimental station of Huazhong Agricultural University.

Tissue Samples and DNA Preparation

Skeletal muscle tissue from an adult Large White and an adult Meishan pig was obtained to prepare complementary DNA (cDNA) and search for SNP. Genomic DNA was isolated from the white blood cells of 16 F1 hybrid pigs from Large White boars and Meishan sows and their fathers according to the standard phenol-chloroform method. Tissues (heart, liver, spleen, lung, kidney, stomach, small intestine, skeletal muscle, fat, uterus, and ovary) from 4 heterozygous pigs (based on SNP) of the 16 F1 hybrid pigs were collected for imprinting analysis.

RNA Isolation and cDNA Synthesis

Total RNA from all tissues collected was isolated with Trizol reagent (Invitrogen, Carlsbad, CA) according to the instructions of the manufacturer. First-strand cDNA was synthesized from 2 µg of total RNA treated with DNase I (TaKaRa, Tokyo, Japan) in a 20-µL reaction volume containing 5 µM oligo(dT)16 primer, 1 x M-MLV first-strand buffer, 40 U of M-MLV reverse transcription (RT), 1 mM of each dNTP, and 8 U of RNase inhibitor (Promega, Madison, WI) at 42°C for 60 min.

PCR of DNA and cDNA

The human PLAGL1 (GenBank accession number NM_006718) and PEG10 (GenBank accession number XM_496907) cDNA sequences were used to search for available expressed sequence tags (EST) in the "EST-others" database using BLAST (http://www.ncbi.nlm.-nih.gov/BLAST/). Pig EST that shared more than 85% sequence identity with the human cDNA sequences were assembled into EST contigs. All primers were designed from the consensus sequence of EST contigs (Table 1Go). Polymerase chain reactions were performed in a 25-µL volume containing 25 ng of porcine cDNA or 50 ng of DNA, 1x PCR buffer, 0.2 µM of each primer, 150 µM of each dNTP, 1.5 mM MgCl2, and 1 U of Taq DNA polymerase (Promega). The PCR conditions were as follows: 94°C for 4 min, 35 cycles of 94°C for 45 s, touchdown annealing from 62°C to 54°C for 50 s (–2°C per cycle), 72°C for 1 min, and a final extension at 72°C for 7 min. Primers (forward: ACCACAGTCCATGCCATCAC and reverse: TCCACCACCCTGTTGCTGTA), which amplify a fragment spanning intron 8 of the GAPDH gene, were applied to exclude the possibility of DNA contamination during all RT-PCR reactions.


View this table:
[in this window]
[in a new window]

 
Table 1. Primer sequences, products amplified, and positions of SNP in the porcine pleomorphic adenoma gene-like I (PLAGL1) and paternal expression gene 10 (PEG10) genes
 
Sequencing and SNP Detection

The RT-PCR products were purified with the Wizard prep PCR purification system (Promega), cloned with pMD18-T easy vector (TaKaRa), and sequenced commercially (AuGCT, Beijing, China). Sequences of Large White and Meishan pigs were aligned with DNAStar software (DNAStar Inc., Madison, WI) to search for SNP.

RFLP of PCR and RT-PCR Products

Eight microliters of PCR or RT-PCR products amplified by primer pairs PL2F/PL2R and PE4F/PE4R (Table 1Go) were incubated at 65°C for 4 h with 3 U of the restriction enzyme TaqI (TaKaRa) and 1 µL attached 10 x Taq 1 Basal Buffer, then electrophoresed at 150 V on a 1.5% (wt/vol) agarose gel.


    RESULTS
 Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Sequence Analysis and SNP Discovery

Primer pairs PL1F/PL1R, PL2F/PL2R, and PL3F/ PL3R for PLAGL1 were used to amplify cDNA made from adult Large White and Meishan skeletal muscle tissues. The 3 primer pairs amplified a 2,238-bp fragment that contained the complete open reading frame encoding 463 AA. Primer pairs PE1F/PE1R, PE2F/ PE2R, PE3F/PE3R, and PE4F/PE4R of the PEG10 gene were used to amplify a total of 6,327 bp containing a 1,105-bp open reading frame and 5,222-bp 3' untranslated region. Both of the cDNA sequences were deposited in the GenBank database (accession numbers DQ288899 and DQ323403). Comparison of the Large White and Meishan sequences revealed a C-T (Large White-Meishan) mutation at position 1,428 (DQ288899) of PLAGL1 and another C-T (Large White-Meishan) mutation at position 5,009 (DQ323403) of the PEG10 gene. The PLAGL1 SNP was a synonymous change in the coding region, and the PEG10 SNP was in the 3' untranslated region. The SNP in the PLAGL1 and PEG10 genes were named PL-SNP and PE-SNP, respectively.

Screening for Heterozygous Individuals

The PLAGL1 SNP and PE-SNP were at positions 448 and 147 of the amplicons produced by primer pairs PL2F/PL2R and PE4F/PE4R, respectively. Both of the SNP could be detected using the restriction enzyme TaqI. Allele T is 706 bp and allele C is 258 and 448 bp for PL-SNP, and allele T is 899 bp and allele C is 498 and 401 bp for PE-SNP. Amplifications of primer pairs PL2F/PL2R and PE4F/PE4R were conducted with genomic DNA from 16 F1 Large White-Meishan hybrid pigs, and the PCR products were digested by TaqI. Results of PCR-TaqI-RFLP indicated that 4 pigs were heterozygous at both PL-SNP and PE-SNP (data not shown).

Imprinting Analysis of PLAGL1 Gene

Reverse transcription PCR of heart, liver, spleen, lung, kidney, stomach, small intestine skeletal muscle, fat, uterus, and ovary from the 4 pigs with primers PL2F/PL2R indicated that the PLAGL1 gene was expressed in all the examined tissues. Restriction fragment length polymorphism analysis of the RT-PCR products showed that the paternally inherited C allele was preferentially expressed in the 44 tissues from the 4 heterozygous pigs (Figure 1Go). The 4 heterozygous pigs had the same expression patterns.


Figure 1
View larger version (42K):
[in this window]
[in a new window]

 
Figure 1. Imprinting status of porcine pleomorphic adenoma gene-like I (PLAGL1). (A) Products amplified by the primer pair PL2F/PL2R. (B) Allelic expression of PLAGL1 as determined by PCR-RFLP. The complementary DNA (cDNA) samples were from 11 different tissues of a C-T heterozygous pig (lanes 1 to 11), and genomic DNA samples were from the pig, its father, and its mother (lanes 12, 13, and 14, respectively). Digestion with TaqI revealed that the PLAGL1 gene is preferentially expressed from the paternally inherited allele C in all of the tissues tested. M = DNA Marker DL2,000 (2,000, 1,000, 750, 500, 250, and 100 bp; TaKaRa, Tokyo, Japan).

 
Imprinting Analysis of PEG10 Gene

Primer pair PE4F/PE4R was used to amplify cDNA from the same tissues mentioned above as well as genomic DNA from their fathers. The RT-PCR products were digested by TaqI. Reverse transcription-PCR-RFLP analysis indicated that the paternal C allele of the PEG10 gene was preferentially expressed in all the tissues (Figure 2Go). There was no difference in the imprinting status of the gene in any of the examined tissues from the 4 pigs.


Figure 2
View larger version (42K):
[in this window]
[in a new window]

 
Figure 2. Imprinting status of paternal expression gene 10 (PEG10). (A) Products amplified by the primer pair PE4F/PE4R. (B) Allelic expression of PEG10 as determined by PCR-RFLP. The complementary DNA (cDNA) samples were from 11 different tissues of a C-T heterozygous pig (lanes 1 to 11), and genomic DNA samples were from the pig, its father, and its mother (lanes 12, 13, and 14, respectively). Digestion with TaqI revealed that the PEG10 gene is preferentially expressed from the paternally inherited allele C in all of the tissues tested. M = DNA Marker DL2,000 (2,000, 1,000, 750, 500, 250, and 100 bp; TaKaRa, Tokyo, Japan).

 

    DISCUSSION
 Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
In this study, a sequencing-based approach and RT-PCR-RFLP method were used to analyze the imprinting status of PLAGL1 and PEG10 genes in various tissues from 4 heterozygous pigs. Our results validated the use of Large White and Meishan hybrids for the analysis of allelic expression. Large White pigs are western breeds, whereas Meishan pigs are of Asiatic origin. These 2 breeds are genetically very different. Therefore, it is easier to search for SNP between Large White and Meishan pigs, including those SNP in exons. The frequency of heterozygous pigs was high in F1 hybrid pigs. Moreover, these Large White x Meishan F1 hybrid pigs could be used to detect the imprinting status of other candidate imprinted genes. Furthermore, the 2 genes were both paternally expressed in 44 tissues from 4 heterozygous pigs, showing that the imprinting analysis using the method of identifying expressed SNP with RT-PCR-RFLP was feasible and believable.

Sequence analysis showed that the porcine PLAGL1 gene shared 90 and 83% identity in nucleotide sequences and 91 and 68% identity in AA sequences compared with human and mouse homologs, respectively. The high identity in nucleotides and AA between human and pigs showed that they may have similar biological function. The PLAGL1 protein, which promotes apoptosis and cell cycle arrest, plays an important role in the control of cell fate during neurogenesis, chondrogenesis, and myogenesis (Hoffmann et al., 2003Go; Valente et al., 2005Go). Paternal duplication of PLAGL1 causes transient neonatal diabetes mellitus, which presents with intrauterine growth retardation (Gardner et al., 1999Go; Ma et al., 2004Go). These observations suggest that PLAGL1 is a candidate gene that may be responsible for fetal growth retardation.

The deduced AA sequence (according to DQ323403) of the porcine PEG10 gene indicated that it had homology to the gag and pol proteins of some vertebrate retrotransposons, which supports the conclusion that PEG10 was derived from a retrotransposon that was previously integrated into the mammalian genome (Ono et al., 2001Go). Generally, integration of a retrotransposon causes imprinted expression of nearby endogenous genes, but PEG10 is the first possible retrotransposable element that has itself become imprinted following its integration in the human genome (Duhl et al., 1994Go; Morgan et al., 1999Go). Further analysis of PEG10 imprinting in pigs may provide important knowledge of the processes associated with genomic imprinting and its evolutionary origin in mammals. The PLAGL1 and PEG10 genes are also both maternally imprinted in pigs similar to their homologs in human and mouse, which indicates the conservation of genomic imprinting across species.

Exogenous expression of the PEG10 protein confers oncogenic activity, and overexpression of the protein decreases cell death mediated by SIAH1, which is a mediator of apoptosis (Okabe et al., 2003Go). The PEG10 knockout mice showed early embryonic lethality owing to defects in the placenta (Ono et al., 2006Go). Li et al. (2006)Go reported that knockdown of PEG10 inhibits the proliferation of Panc1, HepG2, and Hep3B cells and deduced that PEG10 is a c-MYC target gene in cancer cells. We may presume that the PEG10 gene could promote fetal growth. According to the conflict hypothesis (Moore and Haig, 1991Go), paternally expressed genes are predicted to promote fetal growth, whereas maternally expressed genes are predicted to inhibit embryonic growth. Although the imprinting status of the 2 genes was not studied in fetal tissues in our study, because of the conservation of genomic imprinting in different developmental phases and the imprinting status of PEG10 in human and mouse embryos, we could assume that the imprinting status of the PEG10 gene fits the conflict hypothesis. To confirm the conservation of genomic imprinting in different developmental phases and the accordance of the imprinting status of the 2 genes with the conflict hypothesis, the imprinting status of PLAGL1 and PEG10 in porcine fetal tissues needs to be investigated in future studies.


    Footnotes
 
1 This study was funded by the National Natural Science Foundation of China (30571331) and the National High Technology Research and Development Program of China (863 program, 2001AA243031). We thank S. H. Zhao for her help with revision of the manuscript. Back

2 Corresponding author: 030860005{at}webmail.hzau.edu.cn

Received for publication April 30, 2006. Accepted for publication December 13, 2006.


    LITERATURE CITED
 Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 


Duhl, D. M., H. Vrieling, K. A. Miller, G. L. Wolff, and G. S. Barsh. 1994. Neomorphic agouti mutations in obese yellow mice. Nat. Genet. 8:59–65.[CrossRef][Medline]

Estelle, J., A. Mercade, J. L. Noguera, M. Perez-Enciso, C. Ovilo, A. Sanchez, and J. M. Folch. 2005. Effect of the porcine IGF2-intron3-G3072A substitution in an outbred Large White population and in an Iberian x Landrace cross. J. Anim. Sci. 83:2723–2728.[Abstract/Free Full Text]

Gardner, R. J., A. J. Mungall, I. Dunham, J. C. Barber, J. P. Shield, I. K. Temple, and D. O. Robinson. 1999. Localisation of a gene for transient neonatal diabetes mellitus to an 18.72 cR3000 (approximately 5.4 Mb) interval on chromosome 6q. J. Med. Genet. 36:192–196.[Abstract/Free Full Text]

Hoffmann, A., E. Ciani, J. Boeckardt, F. Holsboer, L. Journot, and D. Spengler. 2003. Transcriptional activities of the zinc finger protein Zac are differentially controlled by DNA binding. Mol. Cell. Biol. 23:988–1003.[Abstract/Free Full Text]

Kamiya, M., H. Judson, H. Okazaki, M. Kusakabe, M. Muramatsu, S. Takada, N. Takagi, T. Arima, N. Wake, K. Kamimura, K. Satomura, R. Hermann, D. T. Bonthron, and Y. Hayashizaki. 2000. The cell cycle control gene ZAC/PLAGL1 is imprinted for a strong candidate gene for transient neonatal diabetes. Hum. Mol. Genet. 9: 433–460.

Li, C. M., A. A. Margolin, M. Salas, L. Memeo, M. Mansukhani, H. Hibshoosh, M. Szabolcs, A. Klinakis, and B. Tycko. 2006. PEG10 is a c-MYC target gene in cancer cells. Cancer Res. 66:665–672.[Abstract/Free Full Text]

Ma, D., J. P. Shield, W. Dean, I. Leclerc, C. Knauf, R. R. Burcelin, G. A. Rutter, and G. Kelsey. 2004. Impaired glucose homeostasis in transgenic mice expressing the human transient neonatal diabetes mellitus locus, TNDM. J. Clin. Invest. 114:339–348.[CrossRef][Medline]

Moore, T., and D. Haig. 1991. Genomic imprinting in mammalian development: A parental tug-of-war. Trends Genet. 7:45–49.[Medline]

Morgan, H. D., H. G. Sutherland, D. I. Martin, and E. Whitelaw. 1999. Epigenetic inheritance at the agouti locus in the mouse. Nat. Genet. 23:314–318.[CrossRef][Medline]

Nezer, C., L. Moreau, B. Brouwers, W. Coppieters, J. Detilleux, R. Hanset, L. Karim, A. Kvasz, P. Leroy, and M. Georges. 1999. An imprinted QTL with major effect on muscle mass and fat deposition maps to the IGF2 locus in pigs. Nat. Genet. 21:155–156.[CrossRef][Medline]

Okabe, H., S. Satoh, Y. Furukawa, T. Kato, S. Hasegawa, Y. Nakajima, Y. Yamaoka, and Y. Nakamura. 2003. Involvement of PEG10 in human hepatocellular carcinogenesis through interaction with SIAH1. Cancer Res. 63:3043–3048.[Abstract/Free Full Text]

Okita, C., M. Meguro, H. Hoshiya, M. Haruta, Y. K. Sakamoto, and M. Oshimura. 2003. A new imprinted cluster on the human chromosome 7q21–q31, identified by human-mouse monochromosomal hybrids. Genomics 81:556–559.[CrossRef][Medline]

Ono, R., S. Kobayashi, H. Wagatsuma, K. Aisaka, T. Kohda, T. Kaneko-Ishino, and F. Ishino. 2001. A retrotransposon-derived gene, PEG10, is a novel imprinted gene located on human chromosome 7q21. Genomics 15:232–237.

Ono, R., K. Nakamura, K. Inoue, M. Naruse, T. Usami, N. Wakisaka-Saito, T. Hino, R. Suzuki-Migishima, N. Ogonuki, H. Miki, T. Kohda, A. Ogura, M. Yokoyama, T. Kaneko-Ishino, and F. Ishino. 2006. Deletion of Peg10, an imprinted gene acquired from a retrotransposon, causes early embryonic lethality. Nat. Genet. 38:101–106.[Medline]

Ono, R., H. Shiura, H. Aburatani, T. Kohda, T. Kaneko-Ishino, and F. Ishino. 2003. Identification of a large novel imprinted gene cluster on mouse proximal chromosome 6. Genome Res. 13:1696–1705.[Abstract/Free Full Text]

Piras, G., A. El Kharroubi, S. Kozlov, D. Escalante-Alcalde, L. Hernandez, N. G. Copeland, D. J. Gilbert, N. A. Jenkins, and C. L. Stewart. 2000. Zac1 (Lot1), a potential tumor suppressor gene, and the gene for epsilon-sarcoglycan are maternally imprinted genes: Identification by a subtractive screen of novel uniparental fibroblast lines. Mol. Cell. Biol. 20:3308–3315.[Abstract/Free Full Text]

Reik, W., F. Santos, and W. Dean. 2003. Mammalian epigenomics: Reprogramming the genome for development and therapy. Theriogenology 59:21–32.[CrossRef][Medline]

Ruvinsky, A. 1999. Basics of gametic imprinting. J. Anim. Sci. 77(Suppl. 2):228–237.

University of Otago. 2006. The catalogue of imprinted genes and parent-of-origin effects in humans and animals. http://igc.otago.ac.nz/home.html/ Accessed Dec. 1, 2006.

Valente, T., F. Junyent, and C. Auladell. 2005. Zac1 is expressed in progenitor/stem cells of the neuroectoderm and mesoderm during embryogenesis: Differential phenotype of the Zac1-expressing cells during development. Dev. Dyn. 233:667–679.[CrossRef][Medline]


This article has been cited by other articles:


Home page
Biol. Reprod.Home page
S. R. Bischoff, S. Tsai, N. Hardison, A. A. Motsinger-Reif, B. A. Freking, D. Nonneman, G. Rohrer, and J. A. Piedrahita
Characterization of Conserved and Nonconserved Imprinted Genes in Swine
Biol Reprod, November 1, 2009; 81(5): 906 - 920.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. B. Clark, M. Janicke, U. Gottesbuhren, T. Kleffmann, M. Legge, E. S. Poole, and W. P. Tate
Mammalian Gene PEG10 Expresses Two Reading Frames by High Efficiency 1 Frameshifting in Embryonic-associated Tissues
J. Biol. Chem., December 28, 2007; 282(52): 37359 - 37369.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jas.2006-278v1
85/4/886    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, F. W.
Right arrow Articles by Lei, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, F. W.
Right arrow Articles by Lei, M. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS