J. Anim Sci.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sanchez, M.-P.
Right arrow Articles by Milan, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sanchez, M.-P.
Right arrow Articles by Milan, D.
J. Anim. Sci. 2006. 84:526-537
© 2006 American Society of Animal Science


ANIMAL GENETICS

Effects of quantitative trait loci on chromosomes 1, 2, 4, and 7 on growth, carcass, and meat quality traits in backcross Meishan x Large White pigs1

M.-P. Sanchez*,2, J. Riquet{dagger}, N. Iannuccelli{dagger}, J. Gogué{ddagger}, Y. Billon§, O. Demeure{dagger}, J.-C. Caritez§, G. Burgaud§, K. Fève{dagger}, M. Bonnet{dagger}, C. Péry{ddagger}, H. Lagant*, P. Le Roy*, J.-P. Bidanel* and D. Milan{dagger}

* Station de Génétique Quantitative et Appliquée, INRA, 78352 Jouy-en-Josas Cedex, France; and {dagger} Laboratoire de Génétique Cellulaire, INRA, 31326 Castanet-Tolosan Cedex, France; and {ddagger} Domaine expérimental de Galle, INRA, 18520 Avord, France; and and § Domaine expérimental du Magneraud, INRA, 17700 Surgères, France


    Abstract
 Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 IMPLICATIONS
 LITERATURE CITED
 
The aim of this work was to estimate whether genetic dissection of QTL on chromosomes 1, 2, 4, and 7, detected in an F2 Meishan x Large White population, can be achieved with a recombinant back-cross progeny test approach. For this purpose, a first generation of backcross (BC1) was produced by using frozen semen of F1 Large White x Meishan boars with Large White females. Four BC1 boars were selected because of their heterozygosity for at least 1 of the 4 regions. The BC1 boars were crossed with Large White sows, and the resulting BC2 offspring were measured for several growth and body composition traits. Contrary to the F2 animals, BC2 animals were also measured for meat quality traits in adductor, gluteus superficialis (GS), longissimus dorsi, and biceps femoris (BF) muscles. Each BC1 boar was tested for a total of 39 traits and for the 4 regions with statistical interval mapping analyses. The QTL effects obtained in BC1 families showed some differences compared with those described in F1 families. However, we confirmed QTL effects for growth in the SW1301–SW2512 markers interval on chromosome 1 and also for body composition in the SW1828–SW2512 markers interval on chromosome 1, in the SW2443–SWR783 markers interval on chromosome 2, and in the SW1369–SW632 markers interval on chromosome 7. In addition, we detected new QTL for growth traits on chromosome 2 and for meat quality traits on chromosomes 1 and 2. Growth of animals from weaning to the end of the test was influenced by the IGF2 gene region on chromosome 2. Concerning meat quality, ultimate pH of adductor, longissimus dorsi, and BF were affected by the interval delimited by UMNP3000 and SW2512 markers on chromosome 1, and a* of GS, L* of BF, and water-holding capacity of GS were affected by QTL located between marker loci SW2443 and SWR783 on chromosome 2. Recombinant progeny testing appeared to be a suitable strategy for the genetic dissection of the QTL investigated.

Key Words: backcross • body composition • growth • meat quality • pig • quantitative trait loci


    INTRODUCTION
 Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 IMPLICATIONS
 LITERATURE CITED
 
Quantitative trait loci with strong effects on growth and body composition were detected in an F2 cross between Large White (LW) and Meishan (MS) pigs within the French PorQTL program (Bidanel et al., 2001Go; Milan et al., 2002Go). Significant or suggestive effects were found for 17 different chromosomal regions, but QTL with the largest effects were located on chromosomes 1, 2, 4, and 7. Even if the existence of these QTL was very convincing, they were rather inaccurately located. Thus, confidence intervals, ranging from 11 to 73 cM, have to be reduced to implement efficient marker-assisted selection programs. Moreover, because of possible gene interactions and genetic background or dominance effects, it was important to evaluate the effects of the MS alleles of these QTL in a European genetic background.

Different strategies for QTL fine mapping have been proposed (Darvasi, 1998Go). In line crosses, one way is to use more advanced generations of crossings to increase the number of recombination events. In mice (Lyons et al., 2000Go) and in plants (Fridman et al., 2000Go), successful fine-scale recombination mapping of QTL has been obtained by using strains genetically identical except for the characterized regions surrounding the QTL. In livestock species, genetically homogenous lines do not exist. Nevertheless, recombinant progeny testing seems to be an appropriate strategy to improve QTL mapping efficiency in pigs (Marklund et al., 1999Go). Individuals carrying a distinguishable recombinant chromosome in the initial confidence interval are backcrossed to one of the parental breed (BC) to determine the location of the QTL relative to the recombinant point.

A fine QTL mapping program was initiated for regions affecting growth and body composition on chromosomes 1, 2, 4, and 7 using the frozen semen of the PorQTL F1 LW x MS boars. The aim of the current study was to investigate the effects of QTL identified in an F2 pedigree in first generation backcross (BC1 = F1 x LW) families. In addition, we tested the effects of these regions on several meat quality traits that were not measured in the F2 population.


    MATERIALS AND METHODS
 Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 IMPLICATIONS
 LITERATURE CITED
 
Animals and Measurements

The first generation of backcrossing was generated at the INRA experimental farm of Le Magneraud (Surgères, Charente-Maritimes). Large White sows were inseminated with frozen semen of 2 F1 boars issued from the INRA PorQTL program (Bidanel et al., 2001Go). Among the offspring, 4 BC1 males (S1, S2, S3, and S4) were chosen because they were heterozygous, i.e., they have inherited a MS segment from their sire in at least one QTL region on chromosomes (SSC) 1, 2, 4, or 7. Boars S1, S2, and S3 were full-sibs, whereas the S4 boar came from another sire and another dam. The S1 boar was heterozygous for SSC1 and SSC2 and was recombinant for SSC4; S2 was heterozygous for SSC1 and SSC4; S3 was heterozygous for SSC1, SSC2, and SSC4; and finally, S4 was heterozygous for SSC1, SSC4, and SSC7. The 4 boars were progeny-tested at the INRA experimental farm of Avord (Cher) to confirm the effects detected in the PorQTL program and to estimate the effects of the 4 chromosomal regions on previously unrecorded meat quality traits. Each boar was backcrossed to about 10 LW sows to produce the second generation of backcrossing (BC2).

All BC2 piglets were weaned at 28 d of age and were placed in postweaning collective pens until 10 wk of age. They were then transferred to a fattening unit and submitted to a performance test until they reached approximately 100 kg of live weight. Pigs were individually weighed at birth, at weaning, and at the beginning and end of the performance test. Backfat thickness using real-time ultrasound (Aloka SSD-500, Ecotron Aloka, Tokyo, Japan) was also measured at the end of the test period, on each side of the spine at 4 cm from the middorsal line at the levels of the shoulder (neck), the last rib (back), and the hip joint (rump).

At approximately 105 kg, pigs were slaughtered in a commercial slaughterhouse (Fleury-les-Aubrais, Loiret). Shortly after slaughter, carcass weight and length were taken, and carcass fat depths were measured at the shoulder, the last rib, and the hip joint. Additional fat (G1 and G2) and lean (M2 and M6) depths were recorded using a Fat-o-Meat’er (SFK Technology A/S, Herlev, Denmark) probe. The G1 was measured between the third and the fourth lumbar vertebrae at 8 cm from the middorsal line; G2, M2 (loin eye depth) and M6 (loin eye depth + intercostal muscles depth) were measured between the third and fourth ribs at 6 cm off the middorsal line. The day after slaughter, the whole carcass was weighed, and the right half-carcass was divided into 7 cuts [front and back feet (feet), ham, loin, belly, shoulder, and backfat], which were individually weighed.

Meat quality traits were measured on several muscles. Ultimate pH measurements were taken in samples of adductor, gluteus superficialis (GS), longissimus dorsi, and biceps femoris (BF) muscle using a Knick Portaness 910 pH meter (Knick GmbH & Co., Berlin, Germany) with a Mettler Toledo Probe (Mettler–Toledo International Inc., Urdorf, Switzerland) at 4°C. Water-holding capacity (WHC) and color were evaluated in GS and BF muscles. The WHC was measured using a piece of filter paper put on the freshly cut surface of the muscle and was defined as the time for the paper to become wet (a higher value is associated with a better WHC). Color was measured as 3 coordinates (L*, a*, and b* system) with a Minolta CR-300 chromameter (Konica Minolta, Tokyo, Japan) using the D65 illuminant option and an 11-mm orifice. Values of L* indicate lightness of the meat (a lower value is associated with a darker meat), whereas a* and b* represent the degrees of green-redness and blue-yellowness of the meat, respectively.

A total of 39 traits were defined from the previously mentioned measurements.

The number of offspring measured per sire variedaccording to the trait: from 33 to 44 for S1, from 59 to 68 for S2, from 56 to 71 for S3, and from 27 to 29 for S4.

Molecular Analyses

The BC2 animals and their parents and grandparents were typed for 28 microsatellite markers covering the 4 regions of interest. Six markers were typed at the extremity of the long arm of SSC1 (from 152 to 176 cM), 8 markers at the extremity of the p arm of SSC2 close to the IGF2 locus (from 0 to 24 cM), 6 markers between 48 and 84 cM on SSC4, and finally, 8 markers in the region of SLA on SSC7 (from 54 to 112 cM). The names and locations of microsatellite markers are given in Figure 1Go.


Figure 1
View larger version (36K):
[in this window]
[in a new window]
 
Figure 1. The BC1 (first generation of backcross) sire haplotypes for the 4 regions [Meishan (gray), Large White (black), or unknown (black points on a white background)] and the number of significant traits obtained in each BC1 sire family.

 
The DNA was extracted from blood samples. The amplifications were performed on ABI 9700 PCR machines (Applied Biosystems, Foster City, CA) and the PCR amplification analysis was carried out on an ABI 377 automatic sequencer (Applied Biosystems). The fragment length of the PCR products and the genotype were then determined using the Genescan and the Genotyper softwares (Applied Biosystems), respectively. Results of genotyping were checked, validated, and stored in the GEMMA database (Iannuccelli et al., 1996Go).

Genotype at the intron3-3072 mutation in the IGF2 gene (Van Laere et al., 2003Go) was determined using a PCR-RFLP system. The PCR amplification was performed using the GC-Rich PCR System (Roche, Mannheim, Germany) with the primers: forward-5'GGACCGAGCCAGGGACGAGCCT 3'and reverse-5'AGGGTTCAGCAGTTGCCTTA 3'. Optimal amplification was obtained with an annealing temperature of 59°C in the presence of 1 M GC-Rich solution. Ten microliters of the resulting amplicon were digested during 3 h with 2 U of Tse I (New England Biolabs, Ipswich, UK) restriction enzyme under conditions recommended by the supplier.

Statistical Analyses

Phenotypic data were first adjusted for environmental effects using the GLM procedure of SAS (1999). All traits were corrected for the fixed effects of sex (except Minolta coordinates) and contemporary group, i.e., batch for growth and carcass traits and slaughter date for meat quality traits. Some traits were additionally adjusted to a constant weight by adding it as a linear covariate in the model, i.e., ADG from birth to weaning adjusted with weight at birth; ADG from weaning to the beginning of the test period adjusted with weight at weaning; ADG during the test period adjusted with weight at the beginning of the test period; ultrasonic backfat thickness with weight at the end of the testing period; body composition traits measured on carcass with carcass weight; and pH and WHC measurements with slaughter date.

Interval mapping analyses were then performed on adjusted data in each sire family. A half/full-sib model was used, which assumed that the population was a mixture of half and full-sib families. For each centimorgan along a chromosome, the hypothesis of one QTL (H1) linked to the set of markers considered was compared with the hypothesis of no QTL (H0) at the same location. Under the H1 hypothesis, a QTL with a gene substitution effect for each sire and for each dam was fitted to the data. Likelihoods were then maximized under each hypothesis, and the test statistic was computed as the ratio of likelihoods (L ratio). At the location with the highest L ratio, average substitution effects were estimated within each sire and dam family. For more details on likelihood and gene substitution effect computations, see Le Roy et al. (1998)Go and Bidanel et al. (2001)Go.

Significance thresholds were determined assuming a polygenic infinitesimal model and a normal distribution of phenotypes (Le Roy et al., 1998Go). A total of 1,000 simulations were achieved for each chromosome x sire x trait combination. As tests were not independent because of trait correlations, a canonical decomposition of the correlation matrix of the adjusted data was carried out to find an equivalent number of independent traits. The first 22 eigenvalues explained >95% of the total variability. The number of performed tests was thus considered to be equivalent to 352 elementary tests (22 independent traits x 4 chromosomes x 4 sires). We then retained 4 significance levels (0.05, 3 x 10–3, 5 x 10–4, and 5 x 10–5) in F1 families. For these levels, 18, 1, 0.2, and 0.02 false-positive results were expected, respectively, in BC1 families.


    RESULTS
 Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 IMPLICATIONS
 LITERATURE CITED
 
Results of QTL effects in backcross families are presented in Table 1Go for growth traits, in Table 2Go for ultrasonic backfat thickness, in Table 3Go for carcass body composition traits, and in Table 4Go for meat quality traits and are compared with the results obtained in F2 pigs (Bidanel et al., 2001Go; Milan et al., 2002Go). Figure 1Go additionally recapitulates the main statistical and molecular results for each sire and each chromosome. Additive values were estimated as the difference between the allele transmitted by the MS breed and the allele transmitted by the LW breed. In BC1 families, the sign of the effect indicated a difference between breeds only when the F1 boar was heterozygous and under the assumption that 2 different alleles were fixed in grand parental populations.


View this table:
[in this window]
[in a new window]
 
Table 1. Results of interval mapping analyses for growth traits and comparison of results obtained in F1 and BC1 (first generation of backcross) families
 

View this table:
[in this window]
[in a new window]
 
Table 2. Results of interval mapping analyses for ultrasonic backfat thickness and comparison of results obtained in F1 and BC1 (first generation of back-cross) families
 

View this table:
[in this window]
[in a new window]
 
Table 3. Results of interval mapping analyses for carcass body composition traits and comparison of results obtained in F1 and BC1 (first generation of backcross) families
 

View this table:
[in this window]
[in a new window]
 
Table 4. Results of interval mapping analyses obtained in BC1 (first generation of backcross) families for meat quality traits
 
Growth

Among the 4 regions studied, SSC1 and SSC2 reached significance for several growth traits (Table 1Go). The QTL, located between 172 and 176 cM in the SSC1 region, affected growth from the beginning to the end of the test period. Effects on late growth, primarily detected in F1 families at the end of the long arm of SSC1 (Bidanel et al., 2001Go), were thus confirmed in 2 of the BC1 boar families (S1 and S2). These effects were nevertheless lower in BC1 families than in F1 families and effects on early growth, found in F2 pigs, were not detected in BC1 families. Significant effects were also evidenced at the p-terminal end of SSC2 in 3 BC1 families (S1, S2, and S3). In the S1 family, 4 traits related to growth from weaning to the end of the test period were affected by this region, whereas in both S2 and S3 families, only ADG during the test period was affected by this region. In the F2 population, a suggestive QTL affecting only ADG from weaning to the beginning of the test period was detected (Bidanel et al., 2001Go). No significant results were obtained for growth traits in the 2 other regions (SSC4 and SSC7). The strong effects detected on SSC4 and SSC7 in the F2 population (Bidanel et al., 2001Go) were therefore not found in BC1 families.

In Vivo and Carcass Body Composition

Numerous body composition traits were affected by QTL located in the 4 regions. Effects were particularly high for SSC2 and SSC7 (Tables 2Go and 3Go).

In the SSC1 region, significant effects were detected in 3 boar families (S1, S2, and S3) for different traits depending on the boar: in vivo backfat thickness, carcass fat depths at the level of the neck, ham, belly, feet, G1, G2, M2, and LMC. The QTL were located between 152 and 176 cM., i.e., in the same region as the QTL found in the F2 MS x LW population (Milan et al., 2002Go). However, strong effects on loin weight, detected in the F2 population (Milan et al., 2002Go), were not found in BC1 families.

Very significant effects were detected on the p-terminal end of SSC2 in the region containing the IGF2 gene in 2 BC1 families. Effects on weights of carcass cuts were stronger than those detected in the F2 population (Milan et al., 2002Go), and new effects were detected for fatness traits (ultrasonic and carcass backfat thickness as well as loin, ham, backfat, shoulder, G1, G2, and LMC). In the S1 and S3 families, L ratios reached significance for 13 and 11 traits, respectively. In the S1 boar family, the most likely positions for QTL were in the 0- to 19-cM interval depending on the trait, and effects of the allele transmitted by the F1 grandsire were favorable, except for carcass fat depths at the level of the neck and back. In the S3 boar family, the favorable allele came from the LW granddam, except for loin and ham, and the most likely positions for QTL fell in the 0- to 10-cM interval.

Some significant effects (at the 5% level) were found on SSC4 for carcass or ultrasonic backfat thickness in 3 BC1 sire families (S1, S3, and S4) in the 54- to 83-cM region, comprising the QTL detected in the F2 population (74 to 75 cM; Bidanel et al., 2001Go; Milan et al., 2002Go). However, only 1 and 2 traits, respectively, were affected in the S1 and S4 families, whereas 6 traits were affected in the S3 family.

Numerous traits were also affected by the SSC7 QTL in the S4 boar family. Six backfat thickness measurements, ham, shoulder, backfat, feet, and carcass length showed significant L ratios, 5 of them reached at least the 3 x 10–3 significance level. The most likely position of the QTL ranged from 54 to 112 cM, depending on the trait. These results are similar to those obtained in the F2 population for in vivo backfat thickness (Bidanel et al., 2001Go) although some carcass trait effects detected in the F1 families (Milan et al., 2002Go) could not be detected in the BC1 families, presumably because of the small number of S4 offspring (n = 29) measured for carcass traits.

Meat Quality

Significant effects were detected for meat quality traits on the SSC1 and SSC2 pig genome regions (Table 4Go). Three boars exhibited significant QTL effects on SSC1 for pH measurements; the most likely position of the QTL varied from 167 to 176 cM according to the trait. The QTL detected for ultimate pH of BF reached a 5 x 10–5 significance level in the S1 boar family. Two boar families (S2 and S3) presented significant effects in the SSC2 region. In the S2 family, only a* GS was affected at the 5% level, whereas in the S3 family, 2 meat quality traits (L* of BF at 3 x 10–3 level and WHC of GS at 5% level) were affected. In each of the SSC4 and SSC7 regions, only one meat quality was significant at the 5% level in the S3 and S2 families, respectively.


    DISCUSSION
 Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 IMPLICATIONS
 LITERATURE CITED
 
The aim of fine mapping approaches is to narrow down the chromosomal region that influences the phenotype to a small interval that only contains few genes. In pigs, recombinant progeny testing seems to be an appropriate strategy to improve QTL mapping efficiency (Marklund et al., 1999Go). On pig chromosome 4, a QTL (FAT1) with large effects on fatness and growth, previously identified in an intercross between European wild boar and LW domestic pigs (Andersson et al., 1994Go), has been confirmed in backcross generations (Marklund et al., 1999Go). Among the different QTL identified in the INRA PorQTL experiment, we decided to initiate a fine mapping program in 4 QTL regions using a recombinant backcross progeny test design where recombinant males are mated at each generation to LW sows and progeny-tested. The BC1 animals were used to confirm the existence of growth and body composition QTL on pig chromosomes 1, 2, 4, and 7; to check the potential effects of these regions on meat quality; and to study the QTL effects in a 3/4 LW and 1/4 MS genetic background. With the progeny tests of 4 BC1 boars, we have confirmed most of the growth and body composition effects observed in the F2 cross in the regions located on chromosomes 2 and 7. Less important effects have been obtained in chromosome 1 and particularly in chromosome 4 regions. In addition, we have detected new meat quality effects on chromosomes 1 and 2.

Chromosome 1 QTL

In the telomeric region of the long arm of SSC1, we found significant effects for growth, carcass, and meat quality traits. Suggestive or significant QTL affecting growth rate or backfat depth have previously been reported in this region in different F2 crosses between MS and LW breeds (Rohrer and Keele, 1998Go; De Koning et al., 1999Go; Paszek et al., 1999Go; Rohrer, 2000Go; Bidanel et al., 2001Go; Milan et al., 2002Go). All of these studies reported that the MS allele conferred a greater fat depth and, more surprisingly, a higher growth rate. Moreover, the LW allele presented a significant (over)dominance effect for growth and fat traits. In BC1 families, QTL effects were estimated by comparing the average performance of LW/MS vs. LW/LW offspring. If the LW allele was partially or totally dominant, at least a portion of the QTL effects is expected to be hidden in LW back-cross animals. This hypothesis could explain why the effects detected in F1 families for some growth and body composition traits could not be found in BC1 families. Significant effects for some meat quality traits were additionally detected in this region. Contrary to growth and body composition traits, a limited number of QTL mapping programs have investigated meat quality traits and particularly pH measurements. To our knowledge, the current study is the first one describing meat quality QTL at the end of the long arm of SSC1. Although the 4 boars studied were heterozygous LW/ MS for the entire SSC1 region investigated, significant effects were found in only the S1, S2, and S3 boar families (Figure 1Go). The lack of significant results in the S4 family could be due to the small number of offspring measured in this family (from 27 to 29 offspring depending on the trait), whereas in the 3 other families, from 33 to 71 offspring were measured, depending on the sire and on the trait.

Chromosome 2 QTL

In the region of the IGF2 gene, significant effects were detected for body composition and meat quality traits. Effects were significant for a large number of body composition traits in the progeny of heterozygous LW/MS boars, whereas they were significant for no trait for homozygous LW/LW boars (Figure 1Go). The large effects observed in BC families for backfat thickness are consistent with the results of Knott et al. (1998)Go, De Koning et al. (1999)Go, Jeon et al. (1999)Go, and Nezer et al. (1999)Go, but are different from those obtained in French F1 families where only suggestive QTL were detected (Bidanel et al., 2001Go). This discrepancy is difficult to explain; it may be due to interaction effects between this QTL and other regions of the genome. The most surprising result is that effects are opposite in the 2 families: they are comparable with those observed in F2 pigs for S1 family, with a positive effect of the MS allele on fatness traits and a negative effect on lean cuts weight. Conversely, the LW allele has unfavorable effects in the S3 family. This might indicate the presence of a second locus (Jungerius et al., 2004Go). Boars S1 and S3 were typed for the mutation described in the intron3 of IGF2 (Van Laere et al., 2003Go), and they were found to be heterozygous. As they are full-brothers and have received the same MS chromosome, the observed differences are due to the LW allele they have received. This indicates that the whole variability found in this region in LW populations is not explained by the intron3-3072 mutation. The hypothesis of an additional locus is currently being investigated using BC2 boars homozygous for the intron3-3072 mutation. Differences observed between the results from the F2 French design and those published by De Koning et al. (1999)Go, Jeon et al. (1999)Go, and Nezer et al. (1999)Go relative to the presence or not of imprinting effects could not be tested in these BC families, as all of the females used were pure LW. The effect of the IGF2 intron3-3072 mutation was not investigated further.

Significant effects of this region were also found for some meat quality traits in BC1 families. Conversely to SSC1, some studies have investigated effects of the IGF2 gene region on meat quality, and significant effects were detected for reflectance in a wild boar x LW cross (Jeon et al., 1999Go) and for WHC in a LW x MS cross (Su et al., 2004Go).

Chromosome 4 QTL

Effects found in the SSC4 region were very different in BC2 than in F1 families. Contrary to F1 families, no effect was detected for growth traits in BC1 families, and the body composition traits affected differed in BC1 and F1 families. Andersson et al. (1994)Go identified the presence of a QTL for fatness and growth on pig chromosome 4 (FAT1) in an intercross between European wild pig and LW domestic pigs. They confirmed these results in BC families (Marklund et al., 1999Go) and were able to follow the segregation of the QTL over 4 BC generations. The QTL have also been reported in the same region by other groups, and a combined analysis was performed using data from 7 different crosses among wild boar, European commercial breeds, and Chinese MS breeds (Walling et al., 2000Go). It showed that the fatness QTL had the same location in the different populations and that its effects were significantly larger in wild boar- than in MS-derived populations. Thus, Walling et al. (2000)Go suggested that the QTL had at least 3 different alleles. The lack of effects in BC families tends to indicate that the boars tested are homozygotes at the QTL (except maybe in the S3 family). Localization of QTL by recombinant progeny testing is based on the assumption that different QTL alleles are fixed in MS and LW breeds. Under this assumption, significant effects of a QTL region are expected for heterozygous MS/LW but not for homozygous LW/LW boars. Yet, if QTL alleles are segregating in LW or MS populations, the analyses of several MS/LW boars would lead to different results in different families and result in an erroneous localization of the QTL.

European and Asian pigs were domesticated from different subspecies of the wild boar, and Asian germplasm was introgressed into European pig breeds during the 18th and 19th centuries (Giuffra et al., 2000Go). According to the age of the mutation, both Q and q alleles can be segregating in European domestic pig and MS populations. In this situation, the use of recombinant boars backcrossed to LW females is not appropriate to refine the position of the QTL, except if the females used for the progeny testing are all homozygous for a single haplotype in the tested region.

Chromosome 7 QTL

Results on SSC7 were in accordance with expectations for fatness and most of the carcass composition traits with significant effects in the S4 heterozygous boar family and no effect in the 3 homozygous LW/LW boar families (S1, S2, and S3; Figure 1Go). Conversely, no significant effect could be found for growth traits and some carcass composition traits. We hypothesized that this discrepancy between F2 and BC results is due to the limited size of the S4 boar family. In this family, only 29 BC2 offspring were measured, whereas in the F2 population, QTL effects were estimated with family sizes ranging from 120 to 294 offspring. Despite the small number of pigs, very significant effects were found for some body composition traits, suggesting that a QTL with very strong effects was present in this region. Thus, a fine mapping approach has been initiated in this region, using recombinant BC (Demeure et al., 2005Go).


    IMPLICATIONS
 Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 IMPLICATIONS
 LITERATURE CITED
 
The first generation of backcrossing (BC1) allowed us to show that most QTL effects detected in an F2 population were conserved in backcross pigs and to identify heterozygous boars for 3 QTL regions (S1 and S2 for chromosome 1; S1 and S3 for chromosome 2; S4 for chromosome 7). Using molecular markers, it was then possible to select recombinant BC2 males among the sons of BC1 boars. These BC2 boars will be also progeny-tested and so on for the BC3, BC4, and subsequent generations, until the location of the QTL is accurate enough to use a positional cloning approach. With such a degree of precision, we could improve a given performance by use of a marker/gene-assisted selection program.


    Footnotes
 
1 This experiment was partially funded by the European FatQTL program. Authors gratefully acknowledge the whole staff of the INRA experimental farms of Avord and Le Magneraud for the quantity and the quality of performed measurements as well as the support from the genotyping platform of Genopole Toulouse Midi-Pyrénées where genotyping of animals were performed. Back

2 Corresponding author: marie-pierre.sanchez{at}jouy.inra.fr

Received for publication May 27, 2005. Accepted for publication November 4, 2005.


    LITERATURE CITED
 Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 IMPLICATIONS
 LITERATURE CITED
 


Andersson, L., C. S. Haley, H. Ellegren, S. Knott, M. Johansson, K. Andersson, L. Andersson-Eklund, I. Edfors-Lilja, M. Fredholm, I. Hansson, J. Hakansson, and K. Lundstrom. 1994. Genetic mapping of quantitative trait loci for growth and fatness in pigs. Science 263:1771–1774.[Abstract/Free Full Text]

Bidanel, J. P., D. Milan, N. Iannuccelli, Y. Amigues, M. Y. Boscher, F. Bourgeois, J. C. Caritez, J. Gruand, P. Le Roy, H. Lagant, R. Quintanilla, C. Renard, J. Gellin, L. Ollivier, and C. Chevalet. 2001. Detection of quantitative trait loci for growth and fatness in pigs. Genet. Sel. Evol. 33:289–309.[Medline]

Darvasi, A. 1998. Experimental strategies for the genetic dissection of complex traits in animal models. Nat. Genet. 18:19–24.[Medline]

De Koning, D. J., L. L. G. Janss, A. P. Rattink, P. A. M. van Oers, B. J. de Vries, M. A. M. Groenen, J. J. van der Poel, P. N. de Groot, E. W. Brascamp, and J. A. M. van Arendonk. 1999. Detection of quantitative trait loci for backfat thickness and intramuscular fat content in pig (Sus scrofa). Genetics 152:1679–1690.[Abstract/Free Full Text]

Demeure, O., M. P. Sanchez, J. Riquet, N. Iannuccelli, J. Demars, K. Fève, L. Kernaléguen, J. Gogué, Y. Billon, J. C. Caritez, D. Milan, and J. P. Bidanel. 2005. Exclusion of the SLA as candidate region and reduction of the position interval for the porcine chromosome 7 QTL affecting growth and fatness. J. Anim. Sci. 83:1979–1987.[Abstract/Free Full Text]

Fridman, E., T. Pleban, and D. Zamir. 2000. A recombination hotspot delimits a wild-species quantitative trait locus for tomato sugar content to 484 bp within an invertase gene. Proc. Natl. Acad. Sci. USA 97:4718–4723.[Abstract/Free Full Text]

Giuffra, E., J. M. H. Kijas, V. Amarger, Ö. Carlborg, J.-T. Jeon, and L. Andersson. 2000. The origin of the domestic pig: Independent domestication and subsequent introgression. Genetics 154:1785–1791.[Abstract/Free Full Text]

Iannuccelli, E., N. Woloszyn, J. Arhainx, J. Gellin, and D. Milan. 1996. GEMMA: A database to manage and automate microsatellite genotyping. Anim. Genet. 27(Suppl. 2):55. (Abstr.)[Medline]

Jeon, J. T., O. Carlborg, A. Tornsten, E. Giuffra, V. Amarger, P. Chardon, L. Andersson-Eklund, K. Andersson, I. Hansson, K. Lundstrom, and L. Andersson. 1999. A paternally expressed QTL affecting skeletal and cardiac muscle mass in pigs maps to the IGF2 locus. Nat. Genet. 21:157–158.[Medline]

Jungerius, B. J., A. S. Van Laere, M. F. W. Te Pas, B. A. Van Oost, L. Andersson, and M. A. M. Groenen. 2004. The IGF2-intron3-G3072A substitution explains a major imprinted QTL effect on backfat thickness in a Meishan x European white pig intercross. Genet. Res. Camb. 84:95–101.[Medline]

Knott, S. A., L. Marklund, C. S. Haley, K. Andersson, W. Davies, H. Ellegren, M. Fredholm, I. Hansson, B. Hoyhem, K. Lundström, M. Moller, and L. Andersson. 1998. Multiple marker mapping of quantitative trait loci in a cross between outbred Wild Boar and Large White pigs. Genetics 149:1049–1080.

Le Roy, P., J. M. Elsen, D. Boichard, B. Mangin, J. P. Bidanel, and B. Goffinet. 1998. An algorithm for QTL detection in mixture of full and half sib families. Proc. 6th World Cong. Genet. Appl. Livest. Prod., Armidale, Australia XXVI:257–260.

Lyons, P. A., N. Armitage, F. Argentina, P. Denny, N. J. Hill, C. J. Lord, M. B. Wilusz, L. B. Peterson, L. S. Wicker, and J. A. Todd. 2000. Congenic mapping of the type 1 diabetes locus, Idd3, to a 780-kb region of mouse chromosome 3: Identification of a candidate segment of ancestral DNA by haplotype mapping. Genome Res. 10:446–453.[Abstract/Free Full Text]

Marklund, L., P. E. Nyström, S. Stern, L. Andersson-Eklund, and L. Andersson. 1999. Confirmed quantitative trait loci for fatness and growth on pig chromosome 4. Heredity 82:134–141.

Milan, D., J. P. Bidanel, N. Iannuccelli, J. Riquet, Y. Amigues, J. Gruand, P. Le Roy, C. Renard, and C. Chevalet. 2002. Detection of quantitative trait loci for carcass composition traits in pigs. Genet. Sel. Evol. 34:705–728.[Medline]

Nezer, C., L. Moreau, B. Brouwers, W. Coppieters, J. Detilleux, R. Hanset, L. Karim, A. Kvasz, P. Leroy, and M. Georges. 1999. An imprinted QTL with major effect on muscle mass and fat deposition maps to the IGF2 locus in pigs. Nat. Genet. 21:155–156.[Medline]

Paszek, A. A., P. J. Wilkie, G. H. Flickinger, G. A. Rohrer, L. J. Alexander, C. W. Beattie, and L. B. Shook. 1999. Interval mapping of growth in divergent swine cross. Mamm. Genome 10:117–122.[Medline]

Rohrer, G. A. 2000. Identification of quantitative trait loci affecting birth characters and accumulation of backfat and weight in a Meishan-White composite resource population. J. Anim. Sci. 78:2547–2553.[Abstract/Free Full Text]

Rohrer, G. A., and J. W. Keele. 1998. Identification of quantitative trait loci affecting carcass composition in swine: I. Fat deposition traits. J. Anim. Sci. 76:2247–2254.[Abstract/Free Full Text]

Su, Y. H., Y. Z. Xiong, S. W. Jiang, Q. Zhang, M. G. Lei, R. Zheng, and C. Y. Deng. 2004. Mapping quantitative trait loci for meat quality trait in a Large White x Meishan cross. Acta Genetica Sinica 31:132–136.

Van Laere, A. S., M. Nguyen, M. Braunschweig, C. Nezer, C. Collette, L. Moreau, A. L. Archibald, C. S. Haley, N. Buys, N. Tally, G. Andersson, M. Georges, and L. Andersson. 2003. A regulatory mutation in IGF2 causes a major QTL effect on muscle growth in the pig. Nature 425:832–836.[Medline]

Walling, G. A., P. M. Visscher, L. Andersson, M. F. Rothschild, L. Wang, G. Moser, M. A. M. Groenen, J. P. Bidanel, S. Cepica, A. Archibald, H. Geldermann, D. J. de Koning, D. Milan, and C. S. Haley. 2000. Combined analyses of data from quantitative trait loci mapping studies: Chromosome 4 effects on porcine growth and fatness. Genetics 155:1369–1378.[Abstract/Free Full Text]


This article has been cited by other articles:


Home page
J ANIM SCIHome page
V. Russo, L. Fontanesi, E. Scotti, F. Beretti, R. Davoli, L. Nanni Costa, R. Virgili, and L. Buttazzoni
Single nucleotide polymorphisms in several porcine cathepsin genes are associated with growth, carcass, and production traits in Italian Large White pigs
J Anim Sci, December 1, 2008; 86(12): 3300 - 3314.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
J. Demars, J. Riquet, M.-P. Sanchez, Y. Billon, J.-F. Hocquette, B. Lebret, N. Iannuccelli, J.-P. Bidanel, D. Milan, and F. Gondret
Metabolic and histochemical characteristics of fat and muscle tissues in homozygous or heterozygous pigs for the body composition QTL located on chromosome 7
Physiol Genomics, August 20, 2007; 30(3): 232 - 241.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sanchez, M.-P.
Right arrow Articles by Milan, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sanchez, M.-P.
Right arrow Articles by Milan, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS