|
|
||||||||
ANIMAL GROWTH, PHYSIOLOGY, AND REPRODUCTION |
Division of Nutritional Sciences, School of Biosciences, University of Nottingham, Sutton Bonington Campus, Loughborough, LE12 5RD, UK
| Abstract |
|---|
|
|
|---|
B
, and NF
B by quantitative immunoblotting. Total calpastatin mRNA was increased by 52% (P < 0.05) after treatment with clenbuterol for 1 d and reduced by 35% (P < 0.01) after pST treatment for 7 d. Whereas clenbuterol had no significant differential effects on individual mRNA transcripts (types 1 to 3) derived from the 3 upstream promoters, pST significantly reduced all of these by 51, 39, and 40% (P < 0.001, 0.05, and 0.05), respectively. Promoter activity was increased in rat L6G8 cells transfected with a construct derived from exon 1u after treatment with dibutyryl cAMP (68%, P < 0.05) or forskolin (43%, P < 0.05), whereas 1xa activity was reduced by both of these agents (47 and 33%, respectively, P < 0.05). Treatment of cells with the calcium ionophore calcimycin reduced the activity of the 1u promoter by 40% (P < 0.01), with no effect on the other promoter constructs. Cyclosporin A had no effect on any promoter construct. The only signaling pathway component to be significantly altered by the in vivo treatments was calcineurin, which was decreased by 24% (P < 0.05) in clenbuterol-treated animals. In conclusion, 2 types of growth promoter in pigs had contrasting effects on calpastatin expression in LM. Transfected calpastatin promoters were differentially sensitive to cAMP- and Ca2+-related stimuli, in agreement with the proposed mode of action of the 2 growth promoters.
Key Words: calpastatin calpastatin expression growth promoter pig skeletal muscle
| INTRODUCTION |
|---|
|
|
|---|
Increased calpastatin expression in response to ß-adrenergic stimulation has been associated with skeletal muscle hypertrophy in livestock (Parr et al., 1992
; Killefer and Koohmaraie, 1994
) and correlates inversely with postmortem tenderization rates (Koohmaraie, 1996
). ß-Adrenergic stimulation may act via cyclic adenosine monophosphate (cAMP) responsive elements (CRE) in calpastatin promoter regions (Cong et al., 1998a
,b
). Three promoters located in the 5'region of the gene upstream of exons 1xa, 1xb, and 1u generate calpastatin mRNA transcripts types 1, 2, and 3 respectively (Takano et al., 2000
; Parr et al., 2004
). In the pig, these promoters contain putative motifs for other transcription factors, implying that other signaling pathways could regulate calpastatin expression (Parr et al., 2001
; Raynaud et al., 2005
).
Hypertrophy induced by IGF-I may act via increased cytosolic Ca2+, calcineurin activation, and dephosphorylation of nuclear factor of activated T-cells (NFAT; Musaro et al., 1999
; Semsarian et al., 1999
). A third pathway affecting muscle protein turnover has also been proposed via calpain 3, inhibitor of nuclear factor
B (I
B) cleavage and nuclear factor
B (NF
B) translocation (Baghdiguian et al., 2001
; Combaret et al., 2003
).
In this study, the expression of types 1 to 3 mRNA transcripts generated from the 3 promoters was monitored by real-time PCR in pigs treated with either the ß-agonist clenbuterol or porcine ST (pST). Components of the calcineurin/NFAT and calpain 3/NF
B signaling pathways were also assessed. The responsiveness of cells transfected with different calpastatin promoter constructs to reagents diagnostic of cAMP/PKA or calcineurin/Ca2+ signaling pathways was also investigated.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Animal studies were conducted according to the provisions of the UK Home Office Animals (Scientific Procedures) act of 1986. Two experiments were undertaken. In Exp. 1, 23 Large White type pigs (48.5 ± 1.2 kg of BW; mean ± SEM) were individually penned and fed a standard finisher diet, which they were trained to eat within 2 h, as described previously (Parr et al., 2001
). Animals were allocated to a treatment group 2 d before slaughter. Twenty-four hours before slaughter, the treatment group (n = 12) received the standard diet supplemented with 5 ppm clenbuterol hydrochloride (Sigma-Aldrich, Poole, UK), whereas the control group (n = 11) continued on the standard diet. Clenbuterol was selected as an appropriate ß-agonist as it has previously been reported that a single dose of clenbuterol given 24 h before slaughter is sufficient time to induce an increase in calpastatin expression (Parr et al., 1999b
). In Exp. 2, 21 pigs (34.5 ± 0.75 kg of BW) of similar Large White genotype were housed in individual pens for a period of 6 wk. All pigs were fed a high protein, high energy diet ad libitum, with a specific amino acid composition, formulated to meet the essential requirements for pigs treated with pST (Table 1
), thereby negating any diet-induced differences. After 2 wk, all pigs were injected i.m. in the neck region with 1 mL of vehicle (sterile water) on a daily basis to acclimatize them to the injection procedure. One week before the end of Exp. 2, the pigs were assigned to 2 groups, ensuring that the mean initial BW and backfat measurements were as closely matched as possible. Daily vehicle injections were continued in the control group (n = 10), whereas in the pST-treated group (n = 11) the vehicle was replaced with 5 mg of Reporcin/mL (Reporcin is a synthetic form of pST kindly donated by Alpharma Animal Health, Melbourne, Australia) dissolved in 1 mL of sterile water.
|
Muscle Glycogen Content
To evaluate the effectiveness of the treatment in reducing glycogen stores, muscle glycogen was monitored in samples from Exp. 1 by measuring glucose concentrations produced from glycogen in LM samples taken at slaughter (Dreiling et al., 1987
). Approximately 1 g of muscle was homogenized in 5 volumes of 8% perchloric acid. The homogenate was centrifuged at 15,000 x g for 10 min. Aliquots (133 µL) of the supernatant were neutralized with 100 µL of saturated sodium bicarbonate and 167 µL of 0.2 M sodium acetate buffer, pH 4.8. Amyloglucosidase (80 units/mL; 5 µL) was added to 200 µL of neutralized supernatant and incubated at 37°C for 30 min, before boiling for 5 min to stop the reaction and centrifugation at 15,000 x g for 10 min at room temperature. Glucose was determined using the glucose oxidase-Perid glucose assay (Boehringer Mannheim, London, UK), in which 32 µL of the amyloglucosidase-incubated, neutralized solution was added to 0.8 mL of glucose oxidase solution and incubated for 30 min at 20 to 25°C. Absorbance was measured at 600 nm, and the glucose concentration was calculated from a standard curve.
IGF-I Analysis
Concentrations of IGF-I were measured in plasma samples from Exp. 2 to evaluate the effectiveness of pST treatment. An ELISA kit supplied by DS Laboratories, Oxford, UK, was used. Samples were thawed and extracted in 10 volumes of extraction solution. After a 40-min incubation at room temperature, the samples were centrifuged at 9,000 x g for 3 min. An aliquot of the supernatant (100 µL) was added to an equal volume of Neutralizing Solution (DS Laboratories) and an aliquot of the neutralized extract was diluted 5- to 50-fold using the diluent provided. The extracted samples were incubated overnight at 4°C and allowed to reach room temperature before assaying the IGF-I content.
The assay was carried out in a 96-well plate, with 100 µL of antiIGF-1 antibody conjugated to horseradish peroxidase being added to 20 µL of the extracted sample. After a 2 h incubation period at room temperature, the wells were washed 5 times with buffered saline containing a nonionic detergent. Tetramethylbenzidine chromogen solution (100 µL) was added to each well, and the reactions were stopped after 30 min at room temperature by the addition of 100 µL of 0.2 M sulphuric acid. The absorbance at 450 nm was read, and IGF-I content calculated from a standard curve derived from a set of known synthetic IGF-I standards supplied with the ELISA kit. Where necessary, samples were diluted prior to assay to ensure measurements were obtained within the sensitivity limits of the assay (10600 ng/mL). The mean CV for the assay was less than 4%.
Preparation of Whole-Muscle Homogenates and Nuclei-Enriched Fractions
Whole-muscle homogenates were prepared from LM as previously described (Parr et al., 2001
). Nuclear fractions were prepared as described by Hildebrandt and Neufer (2000)
. All buffers used were ice-cold, filter-sterilized, and had a pH of 7.5. Briefly, fresh tissue was chilled on ice and processed as quickly as possible. Samples of 350 to 400 mg were finely chopped and homogenized in 35 mL of buffer containing 15 mM HEPES, 60 mM KCl, 3 mg/mL BSA, 300 mM sucrose, 100 µg/mL of AEBSF [4-(2-aminoethyl) benzene sulphonyl fluoride], and 1 µg/mL of leupeptin. The homogenate was centrifuged at 2,000 x g for 10 min at 4°C. The supernatant was discarded and 10 mL of buffer containing 15 mM HEPES, 60 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 3 mg/mL of BSA, 100 µg/mL of AEBSF, and 1 µg/mL of leupeptin was added to the pellet and mixed by trituration. The suspension was passed through 1 layer of sterile prewetted muslin without vacuum and centrifuged as previously. The nuclear pellet remaining after discarding the supernatant was resuspended in 10 mL of buffer containing 15 mM HEPES, 60 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 5 mM magnesium acetate, 3 mg/mL of BSA, 300 mM sucrose, 100 µg/mL of AEBSF, and 1 µg/mL of leupeptin and centrifuged at 700 x g for 10 min at 4°C. The supernatant was removed, and the pellet was resuspended in 200 µL of storage buffer containing 75 mM HEPES, 60 mM KCl, 15 mM NaCl, mM magnesium acetate, 0.1 mM EDTA, 0.1 mM EGTA, 40% glycerol, 100 µg/mL of AEBSF, and 1 µg/mL of leupeptin. The suspensions were frozen in liquid nitrogen and stored at 70°C.
Western Blot Analysis of Muscle Preparations
Samples of muscle homogenates and myonuclei were subjected to SDS-PAGE and immunoblotting as described previously (Parr et al., 2001
). Each whole-muscle homogenate sample contained protein derived from 500 µg of wet weight tissue and was immunoprobed for calpain 3 (p94), calcineurin subunit A, and I
B
. Samples of myonuclei preparations containing protein derived from 3 mg of wet weight tissue were immuno-probed for NF
B and NFATc3. The antiporcine calpain 3 antibody was described previously (Parr et al., 1999a
) and used at 1:500 dilution. Polyclonal antisera to human calcineurin (subunit A
; catalogue No. H-209 sc9070), I
B
(catalogue No. FL sc-847), and NFATc3 (catalogue No. M-75 sc8321) were obtained from Santa Cruz Biotechnology Inc., Santa Cruz, CA, and used at dilutions of 1:200, 1:500, and 1:200, respectively. An antiserum to human NF
B was kindly donated by K. Mellits (University of Nottingham, Nottingham, UK) and used at a dilution of 1:1,000 (Mellits et al., 2002
). Secondary anti-rabbit IgG antibodies conjugated to horseradish peroxidase or to alkaline phosphatase were obtained from Amersham Bioscience, UK, and used for ECL (p94, NF
B, I
B
, calcineurin) or CDP Star (NFATc3) respectively. Band intensities were measured using a FluorS Imaging System (BioRad, Hemel Hempstead, UK) and quantified using Quantity 1 software (BioRad). At least 3 replicates of a standard extract were included on every gel to facilitate gel-to-gel comparisons.
Real-Time PCR for mRNA Quantification
Primers and Taqman (PE Applied Biosystems, Warrington, UK) probe combinations for 3 reactions, representing porcine calpastatin Type 1, 2, and 3 mRNA transcripts (accession No. AJ583410, AJ583409), were previously described (Parr et al., 2004
). A fourth generic calpastatin reaction was based on sequences encoding part of inhibitory domain III (accession No. M20160). For this reaction, the forward primer was 5'GGAAAAACTCTCCCGCACAA3', the reverse primer was 5'CAT CAAGGACGAAGTCTTCACTCA3', and the probe was 5'FAM-A C C C C A A G G A A C C A G T C C T G C C C-3'TAMRA. This reaction was designed to monitor all calpastatin transcripts combined. Finally, real-time primer-probe combinations were used to monitor the presence of exon 3 sequences in all transcripts; the forward and reverse primers were; 5'CAGAAACCAA GGCCATTCCA3', and 5'TTGTGTCTTTTCTTGTTGG GAGAA3', respectively, and the probe was 5'FAM TC AGCAAACAGCTGGAAGGACCGC 3'TAMRA (Figure 1
).
|
skeletal actin using SYBR Green fluorescence (Parr et al., 2004Taqman reaction mixtures were prepared with 12.5 µL of 2x Universal Master Mix (PE Applied Biosystems), 5 µL of the cDNA template (diluted 1:40), in a final volume of 25 µL containing forward and reverse primers (300 nM) and probe (200 nM). All real-time PCR reactions were carried out in triplicate on an ABI PRISM 7700 Sequence Detection System (PE Applied Biosystems) using standard default thermal cycling conditions (1 x 50°C for 2 min, 1 x 95°C for 10 min, and 40 x 95°C for 15 s, followed by 60°C for 1 min). A pool of serially diluted first-strand cDNA, representing a mixture of all of the samples on the plate, was used to create a standard curve for quantification of the transcripts, allowing the threshold cycle values for each variant to be converted to the nanograms of total RNA equivalent used for first-strand synthesis. Five separate plates were used to test the effect of ß-agonist treatment in treated and control animals for calpastatin transcripts representing domain III, exon 3, and types 1 to 3 in LM. A similar set of plates was used to carry out the same analysis of mRNA obtained from the pST-treated animals and their respective controls.
Calpastatin Promoter Constructs and Transfections
Three constructs for different calpastatin transcripts, with initiation sites in the 1xa, 1xb, and 1u promoter regions (Aprom 1xa, Aprom1xb, and Aprom 1u, respectively, Figure 1
), were generated by PCR, as described previously (Parr et al., 2004
). Amplicons were ligated into the pGL3 Basic vector (Promega) and used for transfection. Transfections were carried out on L6G8 myoblasts (ECACC No. 92102117, Porton Down, UK), a nonfusing, nondifferentiating cell line derived from rat skeletal muscle. Frozen stocks of cells were thawed and cultured in Dulbeccos Modified Eagles Medium supplemented with 8% fetal calf serum, 4 mM glutamine, 500 µg of penicillin, and 100 µg of streptomycin (growth medium). Cells were harvested (trypsin/EDTA) approximately 24 h before transfection and resuspended in growth medium. After resuspension, harvested cells (500 µL) were aliquoted into individual wells of sterile 48 well plates and incubated at 37°C in the presence of 5% CO2.
The cells were transfected once they had reached 50 to 70% confluence. One hour before transfection, the medium was replaced with prewarmed suspension media. For each construct, an aliquot of serum-free Dulbeccos Modified Eagles Medium was thoroughly mixed with the required quantity of GeneJuice Transfection Reagent (Novagen, Nottingham, UK) at a GeneJuice to DNA ratio of 6:1 (vol/wt). After a 5-min incubation at room temperature, 0.02 µg of pRL-SV40 DNA (transfection efficiency control) was added to each tube, followed immediately by 0.2 µg of promoter reporter construct DNA, pGL3-SV40 control (positive control), or pGL3 basic DNA (negative control). After a 15-min incubation at room temperature, the GeneJuice/DNA mixture was added to the cells. Immediately after transfection, the cells were treated with either 2 mM dibutyryl cAMP, 10 µM forskolin, 1 µM calcimycin, or 10 µM cyclosporin A. The cells were washed with PBS and lysed with Promega Lysis Buffer 24 h after transfection. Firefly and Renilla Luciferase activities were determined on 20 µL of the lysate using the Dual-Glo Luciferase Assay System (Promega). Renilla luciferase activity was used to correct for the efficiency of transfection, and the data were expressed relative to the pGL3-SV40 control-transfected cells.
Data Analysis
Real-time PCR data were compared using Students unpaired t-tests, and immunoreactivity was evaluated by ANOVA (Genstat 8.1, IACR-Rothamsted, UK). Nucleic acid sequence analysis was carried out using packages made available by the UK Human Genome Mapping Project, Middlesex, UK.
| RESULTS |
|---|
|
|
|---|
Muscle glycogen in samples taken from the Exp. 1 was reduced by over 50% in 1 d clenbuterol-treated animals relative to control animals (0.024 and 0.053 µmol of glucose/g of tissue, respectively; SED = 0.004, P < 0.001), indicating that the single dose of clenbuterol administered via feed was effective in reducing intramuscular glycogen stores. Similarly, plasma IGF-I concentrations in samples taken for animals in Exp. 2 showed that the administration of pST for 7 d increased IGF-I concentrations in treated animals by 48% relative to control animals (625 and 423 ng/mL, respectively; SED = 48, P < 0.001).
Effect of Clenbuterol or pST Treatment on mRNA Transcripts
Total RNA was prepared from LM from all animals in both experiments. After reverse transcription, the cDNA preparations were analyzed in 5 Taqman reactions for each experiment, using separate plates for each primer:probe combination. The number of PCR cycles (threshold cycle values) required for the probe fluorescence to reach threshold for the 5 reactions used in the Taqman assay was converted to mRNA abundance using a standard curve and expressed relative to
-skeletal actin expression (Table 2
). Alpha skeletal actin mRNA expression was previously found to be invariant in LM after clenbuterol treatment for 24 h (Parr et al., 2001
). Administration of clenbuterol produced a 51% increase (P < 0.05) in abundance of the domain III calpastatin transcript, representing the sum of all calpastatin transcripts (Table 2
), consistent with previous reports (Parr et al., 1992
, 2001
; Speck et al., 1993
; Killefer and Koohmaraie, 1994
). However, no individual transcript considered separately was significantly affected by clenbuterol treatment, although there were small numerical increases in type 1 and 3 mean values that together could account for the increase in overall calpastatin transcripts. Clenbuterol treatment did produce a significant reduction (30%) in the overall abundance of the exon 3+ transcripts (P < 0.05), which suggests that splicing mechanisms could be sensitive to ß adrenergic stimulation.
|
Effect of Clenbuterol and pST Treatment on Signaling Pathways
Representative immunoblots to detect calpain 3 (Figure 2
, panel a), calcineurin (Figure 2
, panel d), and I
B
(Figure 2
, panel c) in whole-muscle homogenates show bands of 94, 60, and 36 kDa, respectively, consistent with predicted molecular weights for target proteins. Immunoreactive bands of 65 and 190 kDa representing NF
B (Figure 2
, panel b) and NFATc3 (Figure 2
, panel e), respectively, were detected in nuclei-enriched fractions. Multiple replicates of a standard muscle extract were coanalyzed on all gels to permit correction for gel-to-gel variability. The effects of clenbuterol and pST on the transcription factors are illustrated in Table 3
.
|
|
B
or NF
B bands in whole-muscle homogenates or myonuclei, respectively. Treatment with clenbuterol for 1 d, not pST for 7 d, resulted in a 24% reduction (P < 0.01) in the immunoreactivity of the 60-kDa band representing calcineurin in whole-muscle homogenates, which might result from increased proteolysis or suppression of gene expression. The reduction in calcineurin did not, however, affect the concentration of NFATc3 transcription factor measured in the myonuclei-enriched fractions. An essential caveat is that although immunoblotting can indicate changes in total protein abundance, it does not necessarily reveal ß agonist- or pST-induced changes in protein phosphorylation of any of the protein factors studied or treatment-induced changes in calpain 3 and calcineurin catalytic activity by other mechanisms.
Effect of Dibutyryl cAMP, Forskolin, Cyclosporin A, and Calcimycin on Calpastatin Promoter Functionality
The degree of reporter gene expression from the different calpastatin promoter constructs relative to vector controls was similar to that observed previously with L6G8 rat skeletal myoblasts (Parr et al., 2004
). Dibutyryl cAMP, a membrane-permeable form of cAMP that activates PKA, produced a 50% decrease in the efficiency of transcription with the Aprom 1xa promoter construct (P < 0.01) and a 66% increase in transfection from the Aprom 1u promoter (P < 0.05), with no effect on Aprom 1xb (Table 4
). Forskolin, which stimulates adenylate cyclase and cAMP formation, also had the same effect on Aprom 1xa (P < 0.01) and Aprom 1u promoters (P < 0.05). The dibutyryl cAMP treatment caused an increase in expression in the pGL3 control, suggesting that the SV40 promoter was also affected by treatment. Nevertheless, our overall conclusion from the dibutyryl cAMP and forskolin data is that cAMP/PKA signaling is capable of differential effects on the Aprom 1xa and Aprom 1u promoters that generate the predominant mRNA transcripts of calpastatin in porcine LM. The differential expression of Aprom 1xa and Aprom 1u promoters was not, however, reflected in the in vivo experiments with clenbuterol or pST. Treatment with calcimycin, a calcium ionophore that increases cytosolic Ca2+, had the opposite effect on the Aprom 1u promoter, inducing a 40% reduction in expression (P < 0.01), but had little effect on either Aprom 1xa or Aprom 1xb. The calcineurin inhibitor cyclosporin A had no significant effect on any of the promoter constructs in transfected cells. It is concluded that the Ca2+ effect on calpastatin promoter must be acting via an alternative calcineurin-independent pathway (Michel et al., 2004
).
|
| DISCUSSION |
|---|
|
|
|---|
It is well known that feeding ß-adrenergic agonists to livestock over a period of several weeks can lead to marked muscle hypertrophy without hyperplasia (Mersmann, 1998
). The underlying mechanism has not been proven, although an argument has been made for increased expression of calpastatin and a consequent suppression of the rate of myofibrillar turnover by calpain (Bardsley et al., 1992
; Killefer and Koohmaraie, 1994
). Sequencing of bovine and porcine calpastatin promoter regions has revealed characteristic CRE motifs, consistent with a signaling pathway involving ß receptor occupancy, cAMP formation, protein kinase A activation, and phosphorylation of transcription factors such as CREB (Cong et al., 1998a
,b
; Parr et al., 2001
). In pigs and cattle there are at least three 5'calpastatin promoters upstream of exons 1xa, 1xb and 1u (Parr et al., 2001
; Raynaud et al., 2005
). All 3 putative promoter sequences contain motifs consistent with the CRE-mediated mechanism but also several well-known motifs suggestive of the possible involvement of other signaling pathways. Accordingly, it was possible to determine whether mRNA transcripts resulting from transcription at one or more of these promoters show differential induction or repression of any particular transcript in response to ß-adrenergic stimulation.
The real-time PCR reactions indicated that type 1, 2, and 3 transcripts containing exons 1xa, 1xb, and 1u, respectively, are present in porcine LM. Although a significant overall increase in calpastatin mRNA was found after 24-h clenbuterol feeding, as reported previously (Parr et al., 1999b
), it was not possible to say whether any promoter had been stimulated to a greater degree than any other. The low level of stimulation achieved overall may be a consequence of a reduced level of clenbuterol used in the current study, for ethical reasons, compared with previous work (Parr et al., 2001
).
In a number of studies, cardiac and skeletal muscle hypertrophy has been linked to elevated concentrations of calcium and activation of calcineurin, followed by dephosphorylation of cytosolic NFAT and its nuclear translocation (Michel et al., 2004
). The current data indicate that ß-adrenergic stimulation for 1 d reduced the abundance of calcineurin in LM by decreased transcription or proteolysis. However, no changes were seen in the immuno-intensity of NFATc3 in a nuclei-enriched fraction that would be expected to result from suppression of the calcineurin pathway. There are a number of NFAT isoforms, and it is possible that the anti-human NFATc3 antiserum used did not cross-react with its porcine equivalent.
Components of an alternative putative pathway involving calpain 3, I
B
, and NF
B signaling were also monitored by SDS-PAGE and immunoblotting, but no changes were seen that could be attributed to the effect of ß agonist administration. Despite a report that hypertrophic growth in response to ractopamine treatment of pigs over a 24-d period led to a reduction in calpain 3 mRNA (Ji et al., 1992
), we have found no evidence for an interaction between ß adrenergic stimulation and putative calpain3/I
B
/NF
B signaling pathways, at least after a low-dose, short-term treatment.
It is possible that the effect of ß agonists on growth or calpastatin gene expression in muscle could be due to PKA-mediated effects on Ca2+ influx via L-type calcium channels, rather than due to a specific cAMP-mediated signaling pathway. However, the cell transfection study suggests that excess Ca2+ is inhibitory to calpastatin promoter efficiency, probably by a calcineurin-independent mechanism.
Effect of pST on Calpastatin Expression
The mode of action of ST in skeletal muscle hypertrophy is believed to proceed in part via production of IGF-I, an increase of Ca2+ ion concentration, and activation of the calcineurin/NFAT signaling pathway in muscle fibers (Semsarian et al., 1999
; Michel et al., 2004
). It had previously been reported that pST treatment of pigs led to a reduction in calpastatin mRNA in LM, which suggested that pST-induced growth is not based on overexpression of calpastatin to suppress myofibrillar turnover (Ji et al., 1998
). In contrast, other proteolytic systems have been invoked to explain the IGF-Imediated effects on muscle protein degradation (Sachek et al., 2004). Nevertheless, the presence of motifs in calpastatin promoter sequences that are potentially responsive to calcineurin/NFAT signaling pathways led us to explore whether there was a differential response of the multiple calpastatin promoters to pST treatment. There was a 32% reduction of total (domain III) message, and type 1 to 3 mRNA were individually reduced by 51, 39, and 40%, respectively and there was a 53% reduction in Exon 3+ transcripts. Using northern blotting, Ji et al. (1998)
measured the effect of pST treatment over several weeks and found a differential reduction of approximately 65% in 1 of 3 mRNA transcripts separated on the basis of size. The size differential is believed to be attributable to alternative polyA addition signals in the 3'untranslated region (Takano et al., 1988
). To our knowledge, the relationship between alternative promoter usage and splicing in the 5'region of the calpastatin gene leading to types 1 to 3 transcripts described in the present work and alternative polyA signal utilization in the 3'untranslated region is not known.
Ji et al. (1998)
also reported that pST administration did not affect either
actin or calpain 3 mRNA expression in porcine LM. This is consistent with the present observation that neither calpain 3 protein nor its putative signaling partners I
B and NF
B were affected by pST treatment. Indeed no changes were seen in calcineurin or NFATc3 proteins to suggest that relatively short-term pST stimulation, presumably acting via IGF-I, is not activating this signaling pathway. This conclusion is supported by the cell transfection study in which the specific calcineurin inhibitor did not affect reporter gene expression from any of the transfected calpastatin promoter constructs. In contrast there was a significant reduction (40%) in 1u promoter functionality brought about by the Ca2+ ionophore calcimycin, which suggests that IGF-I-mediated effects on calpastatin could be acting by increasing Ca2+ ion concentration but by a calcineurin-independent mechanism (Michel et al., 2004
).
In conclusion, evidence has been obtained of multiple calpastatin promoter usage in porcine LM in control animals and animals treated by 2 distinct types of anabolic agents. Both treatments produced changes in calpastatin mRNA expression, albeit in opposing directions. However, there was no indication in vivo that any one of the three 5'promoters is especially susceptible to short-term ß agonist or pST administration than any other. However, in the cell transfection study, agents that simulate the effects of cAMP and PKA did lead to opposing effects on types 1 and 3 transcripts, with expression from the 1u promoter being significantly increased in 2 independent experiments. Previous work suggests that this promoter is most important in porcine LM (Parr et al., 2004
). Despite the presence of DNA sequence motifs related to NFAT/GATA and NF
B signaling in calpastatin promoters, this study found no evidence of enrichment of NF
B and NFATc3 factors in porcine muscle myonuclei in vivo in response to either of the growth promoters used. However, the clenbuterol-stimulated reduction in cytosolic calcineurin warrants further attention.
The study supports a role for Ca2+ ion as an intermediary in the regulation of calpastatin expression but probably by a calcineurin-independent pathway (Michel et al., 2004
). The ß agonist experiment, however, is consistent with a direct effect of a cAMP/PKA activation of calpastatin expression, which is independent of Ca2+. A role for elevated calpastatin in suppression of myofibrillar protein degradation and hypertrophic growth in response to ß agonist treatment cannot be ruled out. However, if hypertrophic growth associated with pST treatment acts via Ca2+ and a reduction in calpastatin, this could require an interaction with other proteolytic systems that affect myofibrillar proteolysis.
| Footnotes |
|---|
B. We thank Darrell Neufer (Yale University School of Medicine, New Haven, CT) for generous help and advice. This work was supported by a grant from the Biotechnology & Biological Sciences Research Council, UK and a studentship to KJP Ryan. 2 Corresponding author: paul.sensky{at}nottingham.ac.uk
Received for publication February 8, 2006. Accepted for publication June 7, 2006.
| LITERATURE CITED |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
R. J. Rathmann, J. M. Mehaffey, T. J. Baxa, W. T. Nichols, D. A. Yates, J. P. Hutcheson, J. C. Brooks, B. J. Johnson, and M. F. Miller Effects of duration of zilpaterol hydrochloride and days on the finishing diet on carcass cutability, composition, tenderness, and skeletal muscle gene expression in feedlot steers J Anim Sci, November 1, 2009; 87(11): 3686 - 3701. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |