J. Anim Sci.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

J. Anim Sci. 2006. 84:2950-2958. doi:10.2527/jas.2005-726
© 2006 American Society of Animal Science
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sissom, E. K.
Right arrow Articles by Johnson, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sissom, E. K.
Right arrow Articles by Johnson, B. J.

ANIMAL GROWTH, PHYSIOLOGY, AND REPRODUCTION

Melengestrol acetate alters muscle cell proliferation in heifers and steers1

E. K. Sissom, C. D. Reinhardt2 and B. J. Johnson

Department of Animal Sciences and Industry, Kansas State University, Manhattan 66506


   Abstract
Top
 Abstract
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
In vitro experiments were performed to investigate the effects of melengestrol acetate (MGA) or progesterone (P4) on bovine muscle satellite cells and C2C12 myoblasts. Addition of MGA at physiological and supraphysiological concentrations resulted in a dose-dependent decrease (P < 0.05) in DNA synthesis as measured by 3H]-thymidine incorporation (TI). Similarly, P4 addition (0.01 nM) reduced (P < 0.05) TI. Addition of MGA (10 nM) increased (P < 0.05) IGF-I mRNA abundance but did not affect myogenin mRNA. Progesterone addition (10 nM) increased myogenin mRNA abundance (P < 0.05). In C2C12 cultures, P4 addition resulted in a dose-dependent decrease in TI. The antiprogestin RU486, in combination with MGA or P4, also resulted in reduced (P < 0.05) TI. Treatment with RU486 alone had a negative effect (P < 0.05) on TI that was similar to the progestins. Treatment of C2C12 myoblasts with MGA (100 nM) resulted in an increase (P < 0.05) in myogenin mRNA. These studies suggest that progestins may reduce satellite cell proliferation, ultimately affecting carcass composition.

Key Words: bovine • carcass • insulin-like growth factor-I • melengestrol acetate • progesterone • satellite cell


   INTRODUCTION
Top
 Abstract
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Melengestrol acetate (MGA) is an orally active synthetic progestin that has been fed to feedlot heifers in the United States for over 30 yr. There have been equivocal results regarding the effects of MGA on heifer performance (Lauderdale, 1983Go; Adams et al., 1990Go; Hutcheson et al., 1993Go). Furthermore, there is research suggesting MGA may cause early maturity and a subsequent reduction in ribeye area and increase in fat thickness, resulting in a larger proportion of yield grade 4 and 5 heifers (Hutcheson et al., 1993Go). This early maturity may be the result of some molecular mechanism involved in postnatal skeletal muscle growth.

Postnatal skeletal muscle hypertrophy is supported by the contribution of satellite cell nuclei to existing muscle fibers. Satellite cells are mononucleated cells located between the basal lamina and sarcolemma of the muscle fiber (Mauro, 1961Go). Research has shown that anabolic steroids are capable of stimulating the proliferation of satellite cells in vivo (Johnson et al., 1998aGo) and in vitro (Kamanga-Sollo et al., 2004Go). Changes in local production of muscle IGF-I is believed to be partially responsible for the increased satellite cell proliferation (Pampusch et al., 2003Go; Kamanga-Sollo et al., 2004Go).

The enhanced muscle growth reported with androgens and estrogens is undisputed, but to our knowledge there is no information on the effects of progestins on skeletal muscle growth. The purpose of this investigation was to determine the effects of MGA and progesterone on proliferation and gene expression of bovine satellite cells and C2C12 myoblasts.


   MATERIALS AND METHODS
Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 LITERATURE CITED
 
All experimental procedures were approved by the Kansas State University Institutional Animal Care and Use Committee.

Bovine Satellite Cell Experiments
Bovine Satellite Cell Isolation
Satellite cell isolation was conducted as described previously (Johnson et al., 1998aGo). Satellite cells were isolated from six 14-moold crossbred animals, which included 2 heifers and 4 steers. Cattle were killed by captive bolt followed by exsanguination. Using sterile techniques, approximately 500 g of the semimembranosus muscle was dissected and transported to the cell culture laboratory. Subsequent procedures were conducted in a sterile field under a tissue culture hood.

After removal of connective tissue, the muscle was passed through a sterile meat grinder. The ground muscle was incubated with 0.1% Pronase (Calbiochem, La Jolla, CA) in Earl’s Balanced Salt Solution (Sigma, St. Louis, MO) for 1 h at 37°C with frequent mixing. After incubation, the mixture was centrifuged at 1,500 x g for 4 min, the pellet was suspended in PBS (Gibco, Grand Island, NY; 140 mM NaCl, 1 mM KH2PO4, 3 mM KCl, 8 mM Na2HPO4), and the suspension was centrifuged at 500 x g for 10 min. The supernatant was centrifuged at 1,500 x g for 10 min to pellet the mononucleated cells. The PBS wash and differential centrifugation were repeated twice more. The resulting mononucleated cell preparation was suspended in cold (4°C) Dulbecco’s Modified Eagle Medium (DMEM; Gibco) containing 10% fetal bovine serum (FBS; Gibco) and 10% (vol/vol) dimethylsulfoxide (Sigma) and frozen. Cells were stored frozen in liquid nitrogen.

[3H]-Thymidine Incorporation
Bovine satellite cells were plated on 2-cm2 culture plates for thymidine incorporation. Culture plates were precoated with reduced growth factor, basement membrane Matrigel (BD Biosciences, Bedford, MA), which was diluted 1:10 (vol/ vol) with DMEM. Cells were plated in DMEM containing 10% FBS and incubated at 37°C, 5% CO2 in a water-saturated environment. Plating density for cells was established empirically so that all cultures were 25 to 50% confluent after the incubation period. This ensured that cell proliferation rate was not affected by contact inhibition.

In the first set of experiments, 48 h after plating the bovine satellite cells in DMEM containing 10% FBS, the cultures were rinsed 3 times with serum-free DMEM, and the appropriate concentrations of MGA (provided by Pharmacia Corp., Kalamazoo, MI; 0, 0.001, 0.01, 0.1, 1.0, 10, and 100 mM), in DMEM containing 2% bovine serum, were added. In the second set of experiments, 2 µL of MGA or progesterone (P4; Sigma) concentrations (0, 0.001, 0.01, 0.1, 1.0, and 10 nM) were added directly to the cultures immediately after the plating of the cells. At 48 h, cultures were rinsed 3 times with serum-free DMEM, and DMEM containing 10% FBS was added.

For both sets of experiments, at 72 h the cultures were rinsed 3 times with serum-free DMEM, and 1 µCi/ mL of [3H]-thymidine (NEN Life Science, Boston, MA) was added to each well. Cells with [3H]-thymidine were incubated at 37°C, 5% CO2 in a water-saturated environment for 3 h. After this incubation period, the satellite cells were rinsed 3 times with cold, serum-free DMEM to remove free [3H]-thymidine. Cold 5% trichloroacetic acid (Sigma) was added to every well, and the cultures were incubated overnight at 4°C. The following day, the cells were rinsed twice with cold trichloroacetic acid to remove any remaining unincorporated [3H]-thymidine. The precipitated cell material was dissolved in 0.5 mL of 0.5 M NaOH (Sigma) in a rocking incubator for 30 min at 37°C. The NaOH suspensions were transferred quantitatively into scintillation vials containing 10 mL of scintillation cocktail (Fisher Scientific, Han-over Park, IL). The samples were allowed to stand for 2 to 4 h in low light to reduce chemiluminescence before being counted in a scintillation counter. All treatments were measured in triplicate.

RNA Isolation
Bovine satellite cells were plated in DMEM containing 10% FBS as previously described. Melengestrol acetate or P4 (0 and 10 nM) was added to the cultures immediately after plating. At 48 h, the cultures were rinsed 3 times with serum-free DMEM, and fresh DMEM containing 10% FBS was added, along with the appropriate MGA concentrations. At 72 h, total RNA was isolated using the Absolutely RNA Microprep Kit (Stratagene, La Jolla, CA). The abundance of RNA was determined by absorbance at 260nm. Total RNA (1 µg) was reverse-transcribed to produce first-strand complementary DNA (cDNA) using TaqMan Reverse Transcription Reagents and MultiScribe reverse transcription (Applied Biosystems, Foster City, CA) and the protocol recommended by the manufacturer. Random hexamers were used as primers in cDNA synthesis.

Real-Time Quantitative PCR
Real-time quantitative PCR was used to measure the quantity of IGF-I or myogenin gene expression relative to the quantity of 18S ribosomal RNA (rRNA) in total RNA isolated from cultured bovine satellite cells. Measurement of the relative quantity of cDNA was performed using TaqMan Universal PCR Master Mix (Applied Biosystems), 900 nM of the appropriate forward and reverse primers, 200 nM of the appropriate TaqMan detection probe, and 1 µL of the cDNA mixture. The bovine-specific IGF-I and myogenin forward and reverse primers and TaqMan detection probes were synthesized using published GenBank sequences. The sequences were as follows: IGF-I forward primer: TGTGATTTCTTGAAGCAGGT-GAA, reverse primer: AGCACAGGGCCAGATAGAA-GAG, and TaqMan probe: 6-FAM-TGCCCATCACATC-CTCCTCGCA-TAMRA; myogenin forward primer: AGAAGGTGAATGAAGCCTTCGA, reverse primer: GCAGGCGCTCTATGTACTGGAT, and TaqMan probe: 6-FAM-CCCAACCAGAGGCTGCCCAAAGT-TAMRA. Commercially available eukaryotic 18S rRNA primers and probes were used as an endogenous control (Applied Biosystems; GenBank Accession #X03205). The ABI Prism 7000 detection system (Applied Biosystems) was used to perform the assay utilizing the thermal cycling variables recommended by the manufacturer (50 cycles of 15 s at 95°C and 1 min at 60°C). The endogenous 18S rRNA control was used to normalize the expression of IGF-I and myogenin.

C2C12 Myoblast Experiments
Cell Culture
Myoblasts (C2C12; American Type Culture Collection, Manassas, VA) were cultured in DMEM containing 10% FBS. Cells were removed from the culture flask by using 0.05% trypsin (Gibco), which was neutralized by adding DMEM containing 10% FBS. Cells were plated from passages 3 to 8 at 1,000 cells/ cm2 onto 24-well tissue culture plates for cell proliferation, and at 2,000 cells/cm2 onto 6-well plates for gene expression assays. Plates were incubated for 24 h and then rinsed 3 times with warm phenol red-free DMEM, followed by the addition of the appropriate test media for cell proliferation or gene expression assays. Stock solutions of MGA, P4, and RU486 (NIDDK National Hormone and Peptide Program; A. F. Parlow) were dissolved in ethanol to establish a final concentration of 0.2% ethanol for all cultures. Control cultures were exposed to the same concentration of 0.2% ethanol.

[3H]-Thymidine Incorporation
The C2C12 myoblasts were cultured in DMEM containing 10% FBS. Cells were plated as previously described onto 24-well tissue culture plates and incubated 24 h. Cells were rinsed 3 times with warm phenol red-free DMEM and exposed to phenol red-free DMEM plus IGFBP-3-free swine serum (0.5 mg/mL; Kamanga-Sollo et al., 2004Go) containing appropriate additions of MGA, P4, or RU486, alone or in combination. After 48 h in test media, the cells were treated in a similar manner as the bovine satellite cell cultures for [3H]-thymidine incorporation.

RNA Isolation
The C2C12 cells were plated in DMEM containing 10% FBS onto 6-well tissue culture plates at 2,000 cells/cm2. The cells were incubated for 24 h and then rinsed 3 times with phenol red-free DMEM, and MGA or P4 (0, 0.01, 1.0, 10, 100, or 1,000 nM) was added to the cultures. At 72 h, total RNA was isolated and used for first strand synthesis of cDNA, as previously described.

Real-Time Quantitative PCR
Real-time quantitative PCR was used to measure the quantity of IGF-I and myogenin mRNA relative to the quantity of 18S rRNA in total RNA isolated from C2C12 cells. Measurement of the relative quantity of cDNA was performed using TaqMan Universal PCR Master Mix (Applied Biosystems), Assays-on-Demand Gene Expression Products (Applied Biosystems), and 1 µL of the cDNA mixture. The Assays-on-Demand consisted of PCR primers and a TaqMan MGB probe (FAM dye-labeled). Commercially available eukaryotic 18S rRNA primers and probes were used as an endogenous control, as previously described.

Statistical Analysis
Data were analyzed as a completely randomized design using the MIXED model (SAS Inst. Inc., Cary, NC). The difference between control and treatment was determined using the least significant difference procedure. Means were considered significantly different at P < 0.05.


   RESULTS
Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 LITERATURE CITED
 
Bovine Satellite Cells
[3H]-Thymidine Incorporation
Melengestrol acetate was added to bovine satellite cell cultures at concentrations that included physiological (e.g., 10 nM) and supraphysiological (e.g., 100 mM) doses. The physiological concentrations used would be similar to blood concentrations of MGA from a heifer fed the approved dose of MGA. Addition of MGA to cultured bovine satellite cells resulted in a dose-dependent decrease in DNA synthesis as measured by [3H]-thymidine incorporation (Figure 1Go). In Exp. 1, [3H]-thymidine incorporation of bovine satellite cells was reduced (P < 0.05) 27, 25, and 28%, respectively, compared with the control with the low MGA doses. Additionally, high MGA doses further reduced (P < 0.05) [3H]-thymidine incorporation 50 and 57%, respectively, compared with control cultures.


Figure 1
View larger version (8K):
[in this window]
[in a new window]
  		Figure 1. Relative [3H]-thymidine incorporation in bovine satellite cells treated with various doses of melengestrol acetate (MGA) in Dulbecco’s Modified Eagle Medium containing 2% bovine serum. After 24 h exposure to MGA, cells were incubated with 1 µCi of [3H]-thymidine/mL for 3 h. Bars represent the percent difference from control (no MGA added). All data points in individual assays were the average values obtained from 3 wells on each culture dish. a–cBars with different letters differ (P < 0.05). Values are the means of 10 culture dishes derived from 3 animals. Control and 0.001 µM MGA were similar.

 
In the second set of experiments, MGA concentrations spanning the physiological range reduced [3H]-thymidine incorporation compared with control cultures (P < 0.05). Cultures treated with 0.001 nM MGA were not affected; however, addition of 0.01, 0.1, 1.0, and 10 nM MGA reduced [3H]-thymidine incorporation 14, 15, 26, and 30%, respectively (P < 0.05; Figure 2AGo). Progesterone addition of 0.01 nM reduced (P < 0.05) [3H]-thymidine incorporation 22%; however, no other concentrations significantly affected [3H]-thymidine incorporation rate (Figure 2BGo). The cultures in this experiment were treated with progestins 24 h longer than those from the first experiment. This may be a source of explanation for the difference in [3H]-thymidine incorporation with both 1 and 10 nM. The longer exposure to progestins may have affected response to a common dose.


Figure 2
View larger version (9K):
[in this window]
[in a new window]
  		Figure 2. Relative [3H]-thymidine incorporation in bovine satellite cells treated with various doses of melengestrol acetate (MGA; A) or progesterone (P4; B) in Dulbecco’s Modified Eagle Medium containing 10% fetal bovine serum. After 48 h exposure to the treatment, cells were incubated with 1 µCi of [3H]-thymidine/mL for 3 h. Bars represent the percent difference from control (no MGA or P4 added). All data points in individual assays were the average values obtained from 3 wells on each culture dish. a–cBars with different superscripts differ (P < 0.05). Values are means from 4 culture dishes derived from 2 animals. Control and 0.001 nM MGA were similar.

 
Bovine Satellite Cell IGF-I and Myogenin mRNA Abundance
Real-time quantitative PCR analysis was used to assess the effects of MGA and P4 on IGF-I and myogenin mRNA abundance in bovine satellite cell cultures. The IGF-I mRNA abundance was 2.2 times greater (P < 0.05) in cultures treated with MGA compared with control cultures (Figure 3AGo). Insulin-like growth factor-I mRNA abundance was not affected by P4 addition (Figure 3BGo). The addition of MGA did not significantly affect myogenin mRNA abundance (Figure 4AGo). Progesterone treated cultures increased (P < 0.05) myogenin mRNA abundance 2.5 times control cultures (Figure 4BGo).


Figure 3
View larger version (8K):
[in this window]
[in a new window]
  		Figure 3. Relative IGF-I mRNA levels in total RNA isolated from proliferating bovine satellite cell cultures treated with melengestrol acetate (MGA; A) or progesterone (P4; B) for 48 h (0 or 10 nM) in Dulbecco’s Modified Eagle Medium containing 10% fetal bovine serum. After 48 h exposure to the treatment, total RNA was isolated from the cells, and relative mRNA abundance was determined using real-time quantitative PCR. Bars are means ± SE relative to control (no MGA or P4 added). *Bars differ from control (P < 0.05). Values are means from 11 culture dishes derived from 6 animals (A), or 3 culture dishes derived from 3 animals (B).

 

Figure 4
View larger version (8K):
[in this window]
[in a new window]
  		Figure 4. Relative myogenin mRNA levels in total RNA isolated from proliferating bovine satellite cell cultures incubated with melengestrol acetate (MGA; A) or progesterone (P4; B) for 48 h (0 or 10 nM) in Dulbecco’s Modified Eagle Medium containing 10% fetal bovine serum. After 48 h exposure to the treatment, total RNA was isolated from the cells, and relative mRNA abundance was determined using real-time quantitative PCR. Bars are means ± SE relative to control (no MGA or P4 added). *Bars differ from control (P < 0.05). Values are means from 11 culture dishes derived from 6 animals (A), or 4 culture dishes derived from 3 animals (B).

 
C2C12 Myoblasts
[3H]-Thymidine Incorporation
Melengestrol acetate and P4 were added to C2C12 myoblasts to determine direct effects on DNA synthesis as measured by [3H]-thymidine incorporation. Initial studies of proliferation rate in C2C12 myoblasts treated with MGA in FBS resulted in variable effects. Therefore, we used IGFBP-3-free swine serum to inhibit any masking effects caused by the IGFBP-3. Melengestrol acetate and P4 addition (0.01, 1.0, or 100 nM) to C2C12 myoblasts resulted in reduced (P < 0.05) DNA synthesis as measured by [3H]-thymidine incorporation (Figure 5Go). Melengestrol acetate concentrations of 0.01 and 100 nM reduced (P < 0.05) [3H]-thymidine incorporation by 45 and 55%, respectively, compared with the control (Figure 5AGo). Treating cultures with 1 nM MGA reduced (P < 0.05) [3H]-thymidine incorporation 23% compared with control cultures. Progesterone addition to C2C12 myoblasts resulted in a dose-dependent decrease (P < 0.05) in [3H]-thymidine incorporation (Figure 5BGo). The [3H]-thymidine incorporation of C2C12 cells was not affected by the addition of 0.01 nM P4. However, the addition of 1 nM and 100 nM P4 to proliferating C2C12 cells reduced (P < 0.05) [3H]-thymidine incorporation 37 and 42%, respectively, compared with that in control cultures.


Figure 5
View larger version (9K):
[in this window]
[in a new window]
  		Figure 5. Relative [3H]-thymidine incorporation in C2C12 cells treated with various doses of melengestrol acetate (MGA; A), progesterone (P4; B), or RU486 (C) in a IGFBP-3-free media for 48 h. After 48 exposure to treatment, cells were incubated with 1 µCi of [3H]-thymidine/mL for 3 h. Bars represent the percentage difference from control (no MGA, P4, or RU49 = 86 added). All data points in individual assays were the average values obtained from 3 wells on each culture dish. a,bBars with different letters differ from control (P < 0.05). No. of assays = 2.

 
Addition of RU486 alone or in combination with MGA or P4 was used to determine direct effects on DNA synthesis as measured by C2C12 [3H]-thymidine incorporation. A potent inhibitor of progestin action, RU486 binds to the intracellular P4 receptor. The RU486 is unable to block progestin effects not mediated through binding of nuclear receptors (Sager et al., 2003Go). The addition of RU486 to MGA or P4 treated cultures did not attenuate the reduction in [3H]-thymidine incorporation caused by progestin addition (Figure 6Go). Combinations of RU486 (10 nM) and MGA or P4 (1 nM) resulted in antiproliferative effects. The progestin/antiprogestin combination seemed to further reduce proliferation by 12%. Treatment with RU486 alone had a similar antiproliferative effect as the progestins. Addition of RU486 (0.01, 1.0, 10, and 100 nM) resulted in a decrease (P < 0.05) in the rate of [3H]-thymidine incorporation ranging from 25 to 27% (Figure 5CGo).


Figure 6
View larger version (12K):
[in this window]
[in a new window]
  		Figure 6. Relative [3H]-thymidine incorporation in C2C12 cells treated with (A) melengestrol acetate (MGA), RU486, or MGA + RU486 in combination; or (B) progesterone (P4), RU486, or P4 + RU486 in combination in an IGFBP-3-free media for 48 h. After 48 exposure to the treatment, cells were incubated with 1 µCi of [3H]-thymidine/mL for 3 h. Bars represent the percentage difference from control (no added progestin). All data points in individual assays were the average values obtained from 3 wells on each culture dish. a,bBars with different letters differ from control (P < 0.05). No. of assays = 3.

 
C2C12 Myoblast IGF-I and Myogenin mRNA Abundance
Real-time quantitative PCR was used to assess the effects of MGA and P4 (0, 0.01, 0.1, 1.0, 10, 100, or 1,000 nM) on IGF-I and myogenin mRNA abundance in C2C12 myoblasts. Addition of MGA had no significant effect on IGF-I mRNA abundance compared with control cultures (Figure 7AGo). Addition of MGA (100 nM) increased (P < 0.05) myogenin mRNA abundance to 1.9 times that of control cultures (Figure 7BGo).


Figure 7
View larger version (13K):
[in this window]
[in a new window]
  		Figure 7. Relative IGF-I (A) and myogenin (B) mRNA abundance in total RNA isolated from proliferating C2C12 cell cultures incubated with various doses of melengestrol acetate (MGA). After 48 h exposure to MGA, total RNA was isolated from cells, and relative mRNA abundance was determined by using real-time quantitative PCR. Bars are means ± SE relative to control (no MGA added). a,bBars with different letters differ (P < 0.05). No. of assays = 3.

 

   DISCUSSION
Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
LITERATURE CITED
 
The results from this study give rise to possible mechanisms through which MGA may affect carcass composition of feedlot heifers. There have been equivocal results regarding effects of MGA effects on ADG, feed efficiency, and carcass characteristics (Bloss et al., 1966Go; Lauderdale, 1983Go; Adams et al., 1990Go). However, in a review of various feedlot experiments, MGA was not effective in improving ADG or feed efficiency in implanted heifers, but fat thickness and the percentage of heifers with yield grades 4 and 5 increased (Hutcheson et al., 1993Go). Mader and Lechtenberg (2000)Go reported that feeding MGA to heifers implanted with a combination of estradiol and trenbolone acetate reduced gain:feed and caused an increase in carcass fatness and a decrease in longissimus muscle area. Macken et al. (2003)Go demonstrated that feeding MGA to implanted heifers increased twelfth rib fat thickness and greater calculated yield grade.

In intact heifers, MGA prevents ovulation through inhibition of the preovulatory LH surge (Imwalle et al., 2002Go). This allows multiple immature follicles to grow, mature (Mader and Lechtenberg, 2000Go), and subsequently produce and release estrogen, eliciting an endogenous estrogenic growth response (Bloss et al., 1966Go; Zimbelman and Smith, 1966Go; Lauderdale, 1983Go). This mechanism may effectively explain the positive growth response to MGA feeding observed in nonimplanted heifers (Bloss et al., 1966Go; Zimbelman and Smith, 1966Go; Lauderdale, 1983Go) but may also explain why little beneficial growth response to MGA has been observed in implanted heifers (Hutcheson et al., 1993Go; Adams et al., 1990Go; Mader and Lechtenberg, 2000Go). Heifers given an estrogenic or combination estrogenic/androgenic implant may be maximizing their response to the hormonal cascade initiated by exogenous estrogen administration, limiting their response to endogenous estrogen released from the follicles. The response expected from MGA and from the estrogenic implant may be redundant and nonadditive. Further, there may be additional mechanisms of MGA acting directly on the muscle cells that may attenuate the actions of anabolic agents and lead to reduced performance and increased fat deposition. Moseley et al. (2003)Go reported that although feeding MGA to steers did not adversely affect performance, carcass weight, or marbling score, feeding MGA did tend to increase carcass fatness in a dose-dependent fashion.

Androgens and estrogens have anabolic effects in humans, as well as domestic animal species. Steroid-containing compounds have been used as growth promotants in the livestock industry for over 50 yr. Anabolic steroids enhance muscle growth, improve rate of gain, and increase feed efficiency (Johnson et al., 1996Go, 1998aGo; Pampusch et al., 2003Go). Androgens and estrogens are capable of increasing skeletal muscle growth. However, to our knowledge, a specific role for progestins in modulating skeletal muscle growth has not been established.

One putative mechanism of action of androgens and estrogens to stimulate skeletal muscle growth is through affecting proliferation rate of muscle satellite cells (Johnson et al., 1998aGo). Satellite cells are mono-nucleated cells that are capable of proliferating and fusing with existing muscle fibers in order to donate their nuclei to sustain postnatal muscle growth (Moss and Leblond, 1970Go, 1971Go). Anabolic steroids are capable of stimulating the proliferation of satellite cells in vivo and in vitro (Johnson et al., 1998aGo; Kamanga-Sollo et al., 2004Go).

It appears that progestins may have opposite effects of androgens and estrogens in skeletal muscle. In the current study, the addition of MGA to cultured bovine satellite cells resulted in a dose dependent decrease in [3H]-thymidine incorporation with supraphysiological and physiological concentrations. The addition of progesterone significantly reduced (P < 0.05) [3H]-thymidine incorporation at the 0.01 nM concentration; however, no other concentrations resulted in a similar response. This may be due in part to the media utilized in the current study. Kamanga-Sollo et al. (2004)Go reported that IGFBP-3 in media containing swine or fetal bovine serum exhibits antagonistic action on IGF-I bioavailability to proliferating myogenic cells. When media containing swine serum or fetal bovine serum were used, no effect on [3H]-thymidine incorporation was reported following steroid treatment. It was proposed the IGFBP-3 was masking the steroid effect on proliferation and was removed to eliminate any interference it may cause. This may give reasoning to the different response in progesterone cultures compared with MGA cultures. Furthermore, in the experiments utilizing C2C12 myoblasts, MGA and progesterone addition resulted in significant reductions in [3H]-thymidine incorporation when IGFBP-3-stripped media was utilized.

In order to examine the mechanism through which MGA and P4 reduced [3H]-thymidine incorporation rate in C2C12 myoblasts, the antiprogestin RU486 was utilized. Progesterone activity is inhibited by RU486 through the nuclear progesterone receptor (Reveli et al., 1998Go). However, in our experiments, the addition of RU486 to cultures treated with MGA or P4 did not block the reduction in [3H]-thymidine incorporation. Interestingly, RU486 added alone to C2C12 myoblasts resulted in a significant reduction in [3H]-thymidine incorporation similar to MGA and P4 treated cultures. The inability of RU486 to block the effect of MGA and P4 has been demonstrated in other cell types and is referred to as nongenomic actions (Bielefeldt et al., 1996Go; Sager et al., 2003Go). Nongenomic actions do not involve binding to the classic nuclear receptor and therefore are not affected by inhibitors of that mechanism, such as RU486. Additionally, these responses are very rapid and involve second messenger systems such as cyclic AMP or intracellular Ca2+ (Falkenstein et al., 2000Go). These data support the hypothesis that the reduction in [3H]-thymidine incorporation rate observed in C2C12 myoblasts treated with MGA or P4 may be mediated through a nongenomic mechanism, which provides further insight into the direct actions of progestins on skeletal muscle.

Insulin-like growth factor I is a potent stimulator of satellite cell proliferation and differentiation. Furthermore, the mechanism through which anabolic steroids increase proliferation of satellite cells is partially mediated through changes in local production of muscle IGF-I mRNA abundance (Dunn et al., 2003Go; Pampusch et al., 2003Go; Kamanga-Sollo et al., 2004Go). In the satellite cell cultures treated with trenbolone or estradiol, IGF-I mRNA abundance was significantly increased compared with control cultures (Kamanga-Sollo et al., 2004Go). There have also been similar responses of anabolic steroids in vivo. Steers implanted with a combined trenbolone acetate/estradiol implant expressed greater muscle IGF-I mRNA production (Dunn et al., 2003Go; Pampusch et al., 2003Go; White et al., 2003Go). In the current study, MGA increased IGF-I mRNA abundance 2.2 times compared with the control cultures. This was surprising in that MGA and progesterone at the 10 nM concentration were shown to decrease [3H]-thymidine incorporation of the satellite cells. In general, a reduction in [3H]-thymidine incorporation could be a result of reduced local IGF-I concentrations as suggested by previous research (Pampusch et al., 2003Go; Kamanga-Sollo et al., 2004Go). However, IGF-I stimulates the differentiation of cells as well (Johnson and Allen, 1990Go). The increased IGF-I mRNA abundance may be aiding the differentiation process of the cells. Furthermore, the ability of IGF-I to stimulate terminal myogenic differentiation is known to work through the upregulation of the myogenin gene (Florini et al., 1991Go).

The expression of myogenin, a muscle regulator transcription factor, is required for terminal differentiation of muscle cells (Rudnicki and Jaenisch, 1995Go). Satellite cells express myogenin before they have established a postmitotic state as well (Andres and Walsh, 1996Go). Myogenin can be used as an early marker of satellite cell differentiation in proliferating cells before terminal fusion into postmitotic fibers. Research has suggested a role for androgens in myogenin regulation of skeletal muscle differentiation (Lee, 2002Go). In the current study progesterone increased myogenin mRNA abundance 2.5 times in bovine satellite cells. Similarly, MGA (100 nM) increased myogenin mRNA in C2C12 cultures. These results are supported by those of Lee (2002)Go. However, these data contradict those of Kamanga-Sollo and others (2004)Go who showed that trenbolone-treated bovine satellite cells exhibited greater proliferation rates and increased IGF-I mRNA in proliferating cultures, suggesting trenbolone stimulates proliferation rather than differentiation as suggested in the current study.

The results from this study aid in our understanding of the role of progestins in postnatal skeletal muscle growth and differentiation.


   Footnotes
 
1 Contribution #06-135-J, Kansas Agric. Exp. Sta., Manhattan 66506. Back

2 Corresponding author: cdr3{at}ksu.edu

Received for publication December 14, 2005. Accepted for publication June 28, 2006.


   LITERATURE CITED
Top
 Abstract
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 


Adams, T. E., J. R. Dunbar, S. L. Berry, W. N. Garrett, T. R. Famula, and Y. B. Lee. 1990. Feedlot performance of beef heifers implanted with Synovex-H: Effect of melengestrol acetate, ovariectomy or active immunization against GnRH. J. Anim. Sci. 68:3079–3085.[Abstract]

Andres, V., and K. Walsh. 1996. Myogenin expression, cell cycle withdrawal, and phenotypic differentiation are temporally separable events that precede cell fusion upon myogenesis. J. Cell Biol. 132:657–666.[Abstract/Free Full Text]

Bielefeldt, K., L. Waite, F. M. Abboud, and J. L. Conklin. 1996. Nongenomic effects of progesterone on human intestinal smooth muscle cells. Am. J. Physiol. 271:G370–G376.[Medline]

Bloss, R. E., J. I. Northam, L. W. Smith, and R. G. Zimbelman. 1966. Effects of oral melengestrol acetate on the performance of feedlot cattle. J. Anim. Sci. 25:1048–1053.[Abstract/Free Full Text]

Dunn, J. D., B. J. Johnson, J. P. Kayser, A. T. Waylan, E. K. Sissom, and J. S. Drouillard. 2003. Effects of flax supplementation and a combined trenbolone acetate and estradiol implant on circulating insulin-like growth factor-I and muscle insulin-like growth factor-I messenger RNA levels in beef cattle. J. Anim. Sci. 81:3028–3034.[Abstract/Free Full Text]

Falkenstein, E., H. C. Tillmann, M. Christ, M. Feuring, and M. Weh-ling. 2000. Multiple actions of steroid hormones—A focus on rapid, nongenomic effects. Pharmacol. Rev. 52:513–556.[Abstract/Free Full Text]

Florini, J. R., D. Z. Ewton, and S. L. Roof. 1991. Insulin-like growth factor-I stimulates terminal myogenic differentiation by induction of myogenin gene expression. Mol. Endocrinol. 5:718–724.[Abstract]

Hutcheson, D. P., J. R. Rains, and J. W. Paul. 1993. The effects of different implant and feed additive strategies on performance and carcass characteristics in finishing heifers: A review. Prof. Anim. Sci. 9:132–137.

Imwalle, D. B., D. L. Fernandez, and K. K. Schillo. 2002. Melengestrol acetate blocks the preovulatory surge of luteinizing hormone, the expression of behavioral estrus, and ovulation in beef heifers. J. Anim. Sci. 80:1280–1284.[Abstract/Free Full Text]

Johnson, S. E., and R. E. Allen. 1990. The effects of bFGF, IGF-I, and TGF-beta on RMo skeletal muscle cell proliferation and differentiation. Exp. Cell Res. 187:250–254.[CrossRef][Medline]

Johnson, B. J., P. T. Anderson, J. C. Meiske, and W. R. Dayton. 1996. Effect of a combined trenbolone acetate and estradiol implant on feedlot performance, carcass characteristics, and carcass composition of feedlot steers. J. Anim. Sci. 74:363–371.[Abstract/Free Full Text]

Johnson, B. J., N. Halstead, M. E. White, M. R. Hathaway, A. DiCostanzo, and W. R. Dayton. 1998a. Activation state of muscle satellite cells isolated from steers implanted with a combined trenbolone acetate and estradiol implant. J. Anim. Sci. 76:2779–2786.[Abstract/Free Full Text]

Kamanga-Sollo, E., M. S. Pampusch, G. Xi, M. E. White, M. R. Hathaway, and W. R. Dayton. 2004. IGF-I mRNA levels in bovine satellite cell cultures: Effects of fusion and anabolic steroid treatment. J. Cell. Phys. 201:181–189.[CrossRef][Medline]

Lauderdale, J. W. 1983. Use of MGA (melengestrol acetate) in animal production. Pages in 193–232 in Anabolics in Animal Production. E. Meissonnier, ed. Office International des Epizooties, Paris, France.

Lee, D. K. 2002. Androgen receptor enhances myogenin expression and accelerates differentiation. Biochem. Biophys. Res. Commun. 294:408–413.[CrossRef][Medline]

Macken, C. N., C. T. Milton, T. J. Klopfenstein, B. D. Dicke, and D. E. McClellan. 2003. Effects of final implant type and supplementation of melengestrol acetate on finishing feedlot heifer performance, carcass characteristics, and feeding economics. Prof. Anim. Sci. 19:159–170.

Mader, T. L., and K. F. Lechtenberg. 2000. Growth-promoting systems for heifer calves and yearlings finished in the feedlot. J. Anim. Sci. 78:2485–2496.[Abstract/Free Full Text]

Mauro, A. 1961. Satellite cell of skeletal muscle fibers. J. Biophys. Biochem. Cytol. 9:493–495.[Medline]

Moseley, W. M., D. M. Meeuwse, J. F. Boucher, K. J. Dame, and J. W. Lauderdale. 2003. A dose-response study of melengestrol acetate on feedlot performance and carcass characteristics of beef steers. J. Anim. Sci. 81:2699–2703.[Abstract/Free Full Text]

Moss, F. P., and C. P. Leblond. 1970. Nature of dividing nuclei in skeletal muscle of growing rats. J. Cell Biol. 44:459–462.[Free Full Text]

Moss, F. P., and C. P. Leblond. 1971. Satellite cells as the source of nuclei in muscles of growing rats. Anat. Rec. 170:421–435.[CrossRef][Medline]

Pampusch, M. S., B. J. Johnson, M. E. White, M. R. Hathaway, J. D. Dunn, A. T. Waylan, and W. R. Dayton. 2003. Time course of changes in growth factor mRNA levels in muscle of steroid-implanted and nonimplanted steers. J. Anim. Sci. 81:2733–2740.[Abstract/Free Full Text]

Reveli, A., M. Massobrio, and J. Tesarik. 1998. Nongenomic actions of steroid hormones in reproductive tissues. Endocr. Rev. 19:3–17.[Abstract/Free Full Text]

Rudnicki, M. A., and R. Jaenisch. 1995. The MyoD family of transcription factors and skeletal myogenesis. Bioessays 17:203–209.[CrossRef][Medline]

Sager, G., A. Orbo, R. Jaeger, and C. Engstrom. 2003. Non-genomic effects of progestins—Inhibition of cell growth and increased intracellular levels of cyclic nucleotides. J. Steroid Biochem. Mol. Biol. 84:1–8.[CrossRef][Medline]

White, M. E., B. J. Johnson, M. R. Hathaway, and W. R. Dayton. 2003. Growth factor messenger RNA levels in muscle and liver of steroid-implanted and non-implanted steers. J. Anim. Sci. 81:965–972.[Abstract/Free Full Text]

Zimbelman, R. G., and L. W. Smith. 1966. Control of ovulation in cattle with melengestrol acetate: II. Effects on follicular size and activity. J. Reprod. Fertil. 11:193–201.[Medline]


This article has been cited by other articles:


Home page
 J ANIM SCIHome page
S. J. Winterholler, G. L. Parsons, D. K. Walker, M. J. Quinn, J. S. Drouillard, and B. J. Johnson
Effect of feedlot management system on response to ractopamine-HCl in yearling steers
J Anim Sci, September 1, 2008; 86(9): 2401 - 2414.
[Abstract] [Full Text] [PDF]

Home page
 J ANIM SCIHome page
K. Y. Chung and B. J. Johnson
Application of cellular mechanisms to growth and development of food producing animals
J Anim Sci, April 1, 2008; 86(14_suppl): E226 - E235.
[Abstract] [Full Text] [PDF]

Home page
 J ANIM SCIHome page
E. K. Sissom, C. D. Reinhardt, J. P. Hutcheson, W. T. Nichols, D. A. Yates, R. S. Swingle, and B. J. Johnson
Response to ractopamine-HCl in heifers is altered by implant strategy across days on feed
J Anim Sci, September 1, 2007; 85(9): 2125 - 2132.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sissom, E. K.
Right arrow Articles by Johnson, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sissom, E. K.
Right arrow Articles by Johnson, B. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS