J. Anim Sci.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Waylan, A. T.
Right arrow Articles by Sissom, E. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Waylan, A. T.
Right arrow Articles by Sissom, E. K.
J. Anim. Sci. 2004. 82:1868-1875
© 2004 American Society of Animal Science


ANIMAL PRODUCTS

Effect of flax supplementation and growth promotants on lipoprotein lipase and glycogenin messenger RNA concentrations in finishing cattle1

A. T. Waylan, J. D. Dunn, B. J. Johnson2, J. P. Kayser and E. K. Sissom

Department of Animal Sciences and Industry, Kansas State University, Manhattan 66506

Abstract

Lipoprotein lipase (LPL) hydrolyzes triacylglycerols into monoacylglycerol and fatty acids, which are taken up by tissues and used for energy. Glycogenin is the core protein on which glycogen molecules are synthesized. There is one molecule of glycogenin per molecule of glycogen in skeletal muscle; therefore, glycogen storage is limited by the amount of glycogenin present in muscle. The objective of this study was to investigate the effect of feeding flaxseed, a source of PUFA, and administering a growth promoter on steady-state LPL and glycogenin mRNA content of muscle in finishing cattle. Sixteen crossbred steers (initial BW = 397 kg), given ad libitum access to a 92% concentrate diet for 28 d, were used in a four-treatment, 2 x 2 factorial experiment, with flaxseed supplementation (0 or 5% of dietary DM) and implanting (not implanted or implanted with Revalor-S) as the main effects. Muscle biopsies were obtained from the LM at 0, 14, and 28 d, and used to quantify LPL and glycogenin mRNA concentrations using real-time quantitative PCR. Implanting with Revalor-S did not affect LPL (P = 0.13) or glycogenin (P = 0.98) mRNA concentrations. A day x flaxseed interaction (P < 0.001) was observed for both LPL and glycogenin mRNA concentrations. No differences (P > 0.10) were observed between 0 and 5% flaxseed supplemented steers; however, at 28 d, nonflaxseed-fed steers had 4.1- and 5.7-fold increases (P < 0.001) over flaxseed steers for LPL and glycogenin mRNA concentrations, respectively. To further evaluate the effects of {alpha}-linolenic acid ({alpha}-LA) on LPL and glycogenin mRNA concentrations, muscle satellite cells were isolated from five finishing steers, and different {alpha}-LA concentrations were applied in culture. The RNA was isolated from the bovine satellite cells. Addition of {alpha}-LA numerically increased (P = 0.16) the LPL mRNA concentration 48% at 1 µM {alpha}-LA compared with the control. The expression of glycogenin was increased (P < 0.05) 50% at 1 µM {alpha}-LA compared with the control. These results suggest that flaxseed supplementation to finishing steers for 28 d decreased gene expression of both LPL and glycogenin compared with not feeding flaxseed. Alterations in local concentrations of these two proteins could affect the ability of muscle to use fatty acids and glucose for energy, and, ultimately, affect carcass quality.

Key Words: Beef cattle • Estradiol-17ß • Flaxseed • Glycogenin • Lipoprotein Lipase • Trenbolone Acetate

Introduction

Lipoprotein lipase (LPL) is of particular interest in tissues of meat-producing animals because LPL controls the partitioning of fatty acids between adipose tissue and muscle (Hocquette et al., 1998Go). The levels of LPL transcripts are positively related to LPL activity in bovine tissues (Hocquette et al., 1998Go). Therefore, LPL activity may affect beef carcass quality by regulating the available substrates for either muscle or marbling development.

Glycogenin is the core protein upon which glycogen molecules are synthesized. Glycogen storage is limited by the amount of glycogenin present in skeletal muscle (Smythe et al., 1990Go). Because no detectable reserves of glycogenin are found in skeletal muscle (Smythe et al., 1990Go), it is likely synthesized as needed by the muscle. This suggests that the expression of glycogenin might be an indicator of the potential for glycogen stores.

Carcasses from steers implanted with Revalor-S have increased muscling relative to nonimplanted steers (Johnson et al., 1996aGo). Schmidt et al. (2001)Go suggested that one of the challenges to the beef industry was decreased USDA quality grade resulting from the use of growth-promoting implants. Dark-cutting beef is a carcass defect that lowers quality grade and is related to management practices, including implanting cattle, that may impact glycogen status in skeletal muscle (Bergamini, 1975Go).

Flaxseed is an oilseed that is high in {alpha}-linolenic acid ({alpha}-LA), and, when fed to finishing cattle, it increased the percentage of carcasses grading U.S. Choice (LaBrune, 2000Go). Offering {alpha}-LA as an oilseed instead of oil provides a natural partial protection of the lipids against biohydrogenation. Feeding flaxseed and implanting cattle with Revalor-S may improve growth without lowering carcass quality. For this reason, both in vivo and in vitro evaluations were undertaken to evaluate mRNA levels of glycogenin and LPL, two factors involved in energy metabolism and are related to carcass quality.

Materials and Methods

Animals
The Kansas State University Institutional Animal Care and Use Committee approved all experimental procedures. Beginning 27 d before the initiation of the study, steers were adjusted to a 92% concentrate diet (previously described by Dunn et al., 2003Go) offered for ad libitum intake throughout the study. Sixteen yearling crossbred steers with an average initial BW of 397 kg were stratified by weight and used in a 2 x 2 factorial experiment, with ground flaxseed supplementation (0 or 5% of DM) and implanting (nonimplanted or implanted with Revalor-S; 120 mg of trenbolone acetate and 24 mg of estradiol-17ß) as the main effects. Steers assigned to the implant treatments were administered a Revalor-S implant in the right ear following the biopsy procedure (Dunn et al., 2003Go) on d 0. The ADG of these steers were 2.27, 2.08, 1.56, and 1.30 kg/d for nonflaxseed/implanted, flaxseed/implanted, flaxseed/nonimplanted, and nonflaxseed/nonimplanted steers, respectively (Dunn et al., 2003Go). Biopsies from the LM, between the ninth and last rib, were taken from all steers on d 0 (before treatment), 14, and 28 of the trial. The first and third biopsies were on the right side of the steer, but the third biopsy sample was obtained 5 cm anterior to the first. Evaluations in the current study were completed 28 d after application because previous research found, as early as 6 d following implanting (Revalor-S), circulating IGF-I concentrations were higher in implanted cattle than controls (Johnson et al., 1996bGo). Therefore, both enzyme activity and energy stores may be affected by implantation early on during the finishing phase.

Longissimus Muscle Biopsy
Steers were restrained in a hydraulic squeeze chute, hair was removed from the biopsy site, and a local anesthetic (lidocaine HCl; 20 mg/mL; 8 mL/biopsy site) was administered. A sterile drape was placed over the biopsy site, and a 1-cm incision was made. A sterile Bergstrom biopsy needle (6 mm) was used to obtain the tissue (0.5 g) from the LM. The incision was closed with veterinary tissue glue and sprayed with a topical antibiotic spray followed immediately with a spray-on aluminum bandage. All steers were monitored for swelling 24 h after the biopsy.

Sample Preparation and RNA Isolation
Muscle biopsy samples (0.5 g) from each steer were stored suspended in 5 mL of RNALater (Ambion, Austin, TX) in polypropylene tubes at –20°C. Samples were subsequently homogenized in 10 mL of a 5 M guanidine thiocyanate, 50 mM Tris-HC1, 25 mM EDTA, 0.5% lauryl sarcosine, and 1% ß-mercaptoethanol solution, followed by rapid freezing in liquid nitrogen and storage at –80°C for later RNA isolation. Total RNA was isolated according to procedures of Chomczynski and Sacchi (1987)Go. Briefly, sodium acetate (2 M; pH 4.0), phenol, and chloroform:isoamyl alcohol (24:1) were added to a 2-mL aliquot of homogenized LM sample. Samples were vortexed, chilled on ice for 15 min, and centrifuged at 10,000 x g for 20 min at 4°C. The aqueous layer was transferred to a new tube and reextracted following the procedure described previously. After the second extraction, the aqueous layer was transferred to a new tube, mixed with cold isopropanol, chilled on ice for 15 min, and centrifuged at 10,000 x g for 20 min at 4°C. The resulting pellets were dissolved in 1% ß-mercaptoethanol solution, precipitated with 75% ethanol, and dissolved in diethyl pyrocarbonate-treated water. The concentration of RNA was determined by absorbance at 260 nm. Total RNA with ethidium bromide was loaded onto a 1% agarose-formaldehyde gel, and subjected to electrophoresis to allow visualization of 28S and 18S ribosomal RNA (rRNA) to assess the integrity of RNA. After RNA integrity was assessed, samples were DNased to remove any contaminating genomic DNA using a commercially available kit (DNA-free; Ambion, Austin, TX). TaqMan reverse transcription reagents and MultiScribe Reverse Transcriptase (Applied Biosystems, Foster City, CA) were used to produce complimentary DNA (cDNA) from 1 µg of total RNA. Random hexamers were used as primers in cDNA synthesis.

Real-Time Quantitative-PCR
Real-time quantitative PCR was used to measure the quantity of LPL and glycogenin mRNA relative to the quantity of 18S rRNA in total RNA isolated from LM biopsy samples and cultured bovine satellite cells. Measurement of the relative quantity of cDNA was carried out using TaqMan Universal PCR Master Mix (Applied Biosystems), 900 nM of the appropriate forward and reverse primers, 200 nM of appropriate TaqMan detection probe, and 1 µL of the cDNA mixture. The bovine specific LPL and glycogenin forward and reverse primers, as well as TaqMan detection probes, were synthesized using published GenBank sequences (Genbank Accession No. M16966 and L01792, respectively). The sequences for LPL included forward primer, GAACTGGATGGCGGATGAAT; reverse primer, GGGCCCCAAGGCTGTATC; and TaqMan probe, 6FAM-TAACTATCCCCTGGGCAATGTGCATCTC-TAMRA; whereas the sequences for glycogenin were forward primer, CAGCCTTCAGTCGAAACATACAA; reverse primer, CCCCCACCATCAAAACTACCT; and TaqMan probe, 6FAM-CAGCTGTTGCATCTTGCTTCCGAGC-TAMRA.

Commercially available eukaryotic 18S rRNA primers and probe were used as an endogenous control (Genbank Accession No. X03205; Applied Biosystems). Assays were performed in an ABI Prism 7000 sequence detection system (Applied Biosystems) using thermal cycling parameters recommended by the manufacturer (50 cycles of 15 s at 95°C and 1 min at 60°C). Relative expression of LPL and glycogenin was normalized with the 18S rRNA endogenous control using the change in threshhold cycle method and expressed in arbitrary units. Titration of 18S rRNA, LPL, and glycogenin primer against increasing amounts of cDNA provided linear responses with slopes of –3.3 to –3.9.

Satellite Cell Isolation
Satellite cell isolation was done as described previously (Frey et al., 1995Go; Johnson et al., 1998Go). Steers (n = 5) were harvested by captive bolt stunning followed by exsanguination. Using sterile techniques, approximately 500 g of semimembranosus muscle and 10 g of intermuscular adipose tissue (anterior to the semimembranosus) were dissected and transported to the cell culture laboratory. Total RNA was isolated from a subsample of the semimembranosus and adipose tissue, and LPL mRNA concentration was determined as described previously for the muscle biopsy samples. Subsequent procedures on the muscle sample were conducted in a sterile field under a tissue culture hood. After removal of connective tissue, the muscle was passed through a sterile meat grinder. The ground muscle was incubated with 0.1% pronase in Earl’s balanced salt solution for 1 h at 37°C with frequent mixing. Following incubation, the mixture was centrifuged at 1,500 x g for 4 min, the pellet was suspended in PBS (140 mM NaCl, 1 mM KH2PO4), and the suspension was centrifuged at 500 x g for 10 min. The resulting supernatant was centrifuged at 1,500 x g for 10 min to pellet the mononucleated cells. The PBS wash and differential centrifugation was repeated two more times. The resultant mononucleated cell preparation was suspended in cold (4°C) Dulbecco’s modified Eagle’s medium (DMEM), which contained 10% fetal bovine serum (FBS) and 10% (vol/vol) dimethylsulfoxide, and then frozen. Cells were frozen in liquid nitrogen and stored for use in future studies.

Satellite Cell Culture
Primary cultures of bovine satellite cells were isolated from the semimembranosus muscle of five different finishing animals that were not part of the previously described trial. Differentiated cultures routinely were 60 to 75% fused, indicating a majority of myogenic cells. Satellite cells were plated on tissue culture plates (9.62 cm2/well) precoated with reduced growth factor-Matrigel (Becton Dickinson Labware, Franklin Lakes, NJ) diluted 1:9 (vol/vol) with DMEM. Cells were plated in 10% FBS/DMEM and stock solutions of {alpha}-LA (9, 12, 15 – octadecatrienoic acid; L-2376; Sigma Chemical Co., St. Louis, MO) dissolved in ethanol were added to each well immediately after plating to yield concentrations of 0.2% ethanol and either 10 nM or 1 µM {alpha}-LA. Control cultures were also exposed to 0.2% ethanol. All cultures were incubated at 37°C, 5% CO2 in a water-saturated environment. At 48 h, cells were rinsed three times with DMEM, fed with fresh 10% FBS/DMEM, and the same concentrations of {alpha}-LA were restored. Following 72 h fatty acid exposure, total RNA was isolated and DNased from cells using the Absolutely RNA Microprep Kit (Stratagene, La Jolla, CA). Total RNA concentration was determined, cDNA was synthesized, and LPL and glycogenin mRNA concentrations were determined using real-time quantitative PCR as described previously.

Statistical Analyses
Data were analyzed as a completely randomized design, with treatments arranged as a 2 x 2 factorial, with flaxseed supplementation (0 or 5% of DM) and implantation (no implant or implant) as the main effects, and individual steer as the experimental unit. For comparisons pertaining to biopsies over time, a split-plot analysis using the mixed-model procedure of SAS (Release 8.1; SAS Inst., Inc., Cary, NC) was done to account for repeated measurements that included the fixed effect of treatment and biopsy day as the repeated measure. Cell culture data were analyzed as a randomized complete block design with a single factor treatment ({alpha}-LA concentration) at three levels (0, 1 µM, or 10 nM). Again, analyses were performed with the MIXED model procedure of SAS, and the model included the fixed effect of treatment and the random effect of steer. All main effect and interaction means were separated using the least significant difference procedure when the respective F-tests were significant (P < 0.05).

Results

No day x flaxseed x implant interaction was detected (P > 0.05) for either LPL or glycogenin mRNA levels. However, a day x flaxseed interaction (P < 0.001) was observed for both LPL and glycogenin mRNA concentrations in muscle biopsy samples (Figures 1Go and 3Go). At 0 and 14 d, no differences (P > 0.10) were detected between 0 and 5% flaxseed-fed steers. At 28 d, however, steers fed 0% flaxseed had 4.1- and 5.7-fold higher (P < 0.001) LPL and glycogenin mRNA concentrations, respectively, than did steers fed 5% flaxseed. Revalor-S did not (P > 0.10) affect LPL or glycogenin mRNA concentrations (Figures 2Go and 4Go).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 1. Influence of day of muscle biopsy on lipoprotein lipase steady-state messenger RNA (mRNA) concentrations of flaxseed fed steers (0 or 5% of DM). Biopsy samples of the LM were taken on alternating sides beginning on d 0 (before flaxseed was fed) and again on d 14 and 28. The RNA was isolated from the muscle biopsy samples and used to produce complimentary DNA, which was quantified with real-time quantitative PCR, comparing the quantity of lipoprotein lipase relative to the quantity of 18S rRNA. Bars represent the least squares means and SE for the analysis of eight steers. *Denotes that the two means at 28 d were different (P < 0.05).

 


View larger version (15K):
[in this window]
[in a new window]
 
Figure 3. Influence of day of muscle biopsy on glycogenin steady-state messenger RNA concentrations of flaxseed fed steers (0 or 5% DM). Biopsy samples of the LM were taken on alternating sides beginning on d 0 (before flaxseed was fed) and on d 14 and 28. The RNA was isolated from the muscle biopsy samples and used to produce complimentary DNA, which was quantified with real-time quantitative PCR, comparing the quantity of glycogenin relative to the quantity of 18S rRNA. Bars represent the least squares means and SE for the analysis of eight steers. *Denotes that the two means at 28 d were different (P < 0.05).

 


View larger version (15K):
[in this window]
[in a new window]
 
Figure 2. Influence of day of muscle biopsy on lipoprotein lipase steady-state messenger RNA concentrations of implanted (Revalor-S) steers. Biopsy samples of the LM were taken on alternating sides beginning on d 0 (before implanting with Revalor-S) and again on d 14 and 28. The RNA was isolated from the muscle biopsy samples and used to produce complimentary DNA, which was quantified with real-time quantitative PCR, comparing the quantity of lipoprotein lipase relative to the quantity of 18S rRNA. Bars represent the least squares means and SE for the analysis of eight steers.

 


View larger version (14K):
[in this window]
[in a new window]
 
Figure 4. Influence of day of muscle biopsy on glycogenin steady-state messenger RNA concentrations of implanted (Revalor-S) steers. Biopsy samples of the LM were taken on alternating sides beginning on d 0 (before implanting with Revalor-S) and again on d 14 and 28. The RNA was isolated from the muscle biopsy samples and used to produce complimentary DNA, which was quantified with real-time quantitative PCR, comparing the quantity of glycogenin relative to the quantity of 18S rRNA. Bars represent the least squares means and SE for the analysis of eight steers.

 
To attain preliminary data on the expression of LPL in both skeletal muscle and adipose tissues, samples were taken at the time of a satellite cell isolation preparation. Results indicated that LPL mRNA is present in both tissues, but, as expected, LPL mRNA levels were higher (P < 0.05) in adipose tissue than in skeletal muscles (140.4 vs 9.4 arbitrary units, respectively). The approximate 15-fold increase in LPL mRNA observed in the intermuscular adipose tissue indicates that adipose tissue had greater steady-state mRNA concentrations of LPL, but LPL mRNA was present in skeletal muscle as described in other studies (Semenkovich et al., 1989Go; Goldberg and Merkel, 2001Go).

To further evaluate the effects of {alpha}-LA on LPL and glycogenin mRNA concentrations, RNA was isolated from bovine satellite cells that had differing {alpha}-LA concentrations applied during culture. The addition of 1 µM {alpha}-LA numerically increased (P = 0.16) the LPL mRNA concentration 48% compared to the control (Figure 5Go). Furthermore, the expression of glycogenin was numerically higher at 10 nM and increased (P < 0.05) at 1 µM {alpha}-LA. In comparison with the control, a 9 and 50% increase in glycogenin mRNA at 10 nM and 1 µM {alpha}-LA, respectively, was observed (Figure 6Go). Noted by the arbitrary units, the abundance of mRNA was higher for both LPL and glycogenin in the cell cultures compared with the muscle tissue samples. This would be expected as the cell cultures contain mostly satellite cells, whereas the muscle samples would contain primarily developed multinucleated muscle fibers.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 5. Lipoprotein lipase steady-state messenger RNA concentration in cultures of satellite cells cultured with increasing levels of {alpha}-linolenic acid. Bovine satellite cells were isolated from five different animals. The satellite cells were exposed to the different concentrations of {alpha}-linolenic acid immediately after plating, and after 72 h, total RNA was isolated from these cultures and used to produce complimentary DNA. Complimentary DNA was quantified with real-time quantitative PCR to compare the quantity of lipoprotein lipase relative to the quantity of 18S rRNA. Bars represent the means and SE for the analysis of five separate experiments.

 


View larger version (18K):
[in this window]
[in a new window]
 
Figure 6. Glycogenin steady-state messenger RNA concentration in cultures of satellite cells cultured with increasing levels of {alpha}-linolenic acid. Bovine satellite cells were isolated from five animals. The satellite cells were exposed to different concentrations of {alpha}-linolenic acid immediately after plating, and after 72 h, total RNA was isolated from these cultures and used to produce complimentary DNA. Complimentary DNA was quantified with real-time quantitative PCR to compare the quantity of lipoprotein lipase relative to the quantity of 18S rRNA. Bars represent the means and SE for the analysis of five separate experiments. Means (bars) that do not have a common letter differ (P < 0.05).

 
Discussion

Increased use of price grids for the sales of finished cattle has prompted researchers to evaluate different mechanisms that affect carcass quality. LaBrune (2000)Go reported that the addition of ground flaxseed to beef cattle finishing diets resulted in improved marbling scores and increased the percentage of carcasses grading U.S. Choice. The composition of flaxseed is approximately 40% oil, with 50% of the fatty acid content being the PUFA, {alpha}-LA. Even though research (Doreau and Ferlay, 1994Go) has indicated that linolenic acid is often hydrogenated to stearic acid, offering the oilseeds to ruminants instead of oils provides natural partial protection to lipids against biohydrogenation in the rumen (Ekeren et al., 1992Go). This also was supported by LaBrune (2000)Go, who found feeding flaxseed in finishing cattle diets resulted in higher levels of {alpha}-LA in both plasma and in LM steaks. It was hypothesized in the current study that feeding flaxseed might allow for increased LPL mRNA concentrations in the muscle, possibly explaining the increased marbling scores previously observed in carcasses from steers fed flaxseed. Therefore, the benefit of increased lean tissue accretion from implantation (Johnson et al., 1996aGo) without the negative carcass effects may be observed. Supplementing steers with flaxseed did result in a day x flaxseed interaction for LPL mRNA concentrations in the LM; however, the 312% increase in the expression of LPL for the nonflaxseed fed steers compared with the flaxseed-fed steers was somewhat surprising. This raises the possibility that the expression of LPL may only be increased in the adipose tissue of the flaxseed-fed steers because the demand for energy in the muscle is being met, and allowing the fatty acids to be partitioned to metabolize intramuscular adipose tissue. Hence, the expression of LPL may be higher in the adipose tissue than in the muscle in the flaxseed-fed steers. Hocquette et al. (1998)Go found LPL activity and mRNA concentrations to be positively correlated in bovine tissue; therefore, if the LPL mRNA levels were increased in the adipose tissue, the LPL activity would also be increased in the adipose tissue of the flaxseed-fed steers. Another reason the expression of LPL was higher in the muscle of the nonflaxseed fed steers compared to flax-fed steers at d-28 was that these steers might need additional energy to sustain protein accretion. Hocquette et al. (2001)Go found that LPL activity and gene expression were reduced after weaning in adipose tissue, but not in muscle. This indicates that the time of weaning, as well as age (Semenkovich et al., 1989Go), of the steers may be affecting the LPL gene expression in the current study. Semenkovich et al. (1989)Go found that the maximal levels of LPL mRNA in adipose tissue were detected at the earliest time points studied, but increased concentrations in muscle tissues were observed as the steer grew (d 28 in nonflaxseed fed steers), which was also observed in the current study. At d-28 of the trial, the nonflaxseed-fed steers had higher LPL mRNA levels than the flaxseed-fed steers. Again, these results support that LPL is needed at this time point to partition fatty acids toward muscle development.

Implanting steers with Revalor-S did not affect LPL mRNA concentration in the LM. The mechanism of i.m. fat deposition is not known; however, adipose tissue development is attributed to either an increase in adipocyte number, an increase in adipocyte size, or a combination of the two (Cianzio et al., 1985Go). An increase in adipocyte size is the result of the increased availability of fatty acids for lipid filling. Johnson et al. (1996) reported that as early as 6 d after implantation with Revalor-S, IGF-I levels were increased compared with nonimplanted steers. These findings indicate that implanting cattle affect growth factor levels that influence muscle growth at the early stages of finishing. Hence, energy stores and the level of LPL mRNA may also be affected immediately after implanting, which may ultimately affect carcass quality. These results indicate that implant did not have an affect on the expression of LPL mRNA in muscle tissue during the first 28 d on trial. Therefore, without an observed increase in LPL, implanting steers did not increase partitioning of fatty acids toward muscle growth. This suggests that fatty acids would be available for the development of marbling in implanted animals, which is contrary to the findings that yearling steers implanted with Synovex-Plus or Revalor-S had lower marbling scores than nonimplanted steers (Hermesmeyer et al., 2000Go).

Following the same trend as LPL, a day x flaxseed interaction was observed for glycogenin. The expression of glycogenin in the flaxseed steers did not change throughout the feeding period. This indicates that having the added PUFA and the changeover to a high concentrate diet allows both glucose and fatty acids to be available to maintain homeostasis in both glycogen and fatty acid metabolism. However, the glycogenin mRNA concentration decreased numerically from d 0 to d 14 in the non-flaxseed fed cattle. There are two ways that glycogen storage can be expanded: either by the conversion of proglycogen to macroglycogen (additional glucose units are attached to the proglycogen molecule) or by increasing the number of glycogenin copies through gene expression (Alonso et al., 1995Go). The amount of glycogenin will influence how much glycogen the cell can store (Alonso et al., 1995Go). Additionally, the formation of both pro- and macroglycogen are sensitive to nutritional intake (Adamo et al., 1998Go). Glycogen primarily oscillates between the size of macro- and proglycogen (Derave et al., 2000Go), suggesting that glycogen storage is first increased by the formation of macroglycogen, and, secondly, by increasing the number of glycogenin molecules. A 5.7-fold increase in the glycogenin mRNA concentration in the nonflaxseed steers compared with the flaxseed steers was observed at 28 d. At 28 d, time has been allowed for the increased gene expression of glycogenin (Alonso et al., 1995Go), possibly resulting in a greater number of glycogenin molecules in the muscle. These results indicate that the nonflaxseed fed steers may increase their glycogen stores by producing glycogenin, whereas flaxseed fed steers are adding the glucose molecules to existing proglycogen molecules.

The concentration of glycogen in muscle at slaughter is one of the most important factors affecting beef quality. Without sufficient muscle glycogen, a discounted defect termed dark-cutting beef may occur. Implanting did not affect the glycogenin mRNA concentration in muscle. Growth-promoting implants may attribute to dark-cutting beef (Scanga et al., 2001Go), which is a result of decreased glycogen stores. Therefore, the concentration of glycogenin, the core protein upon which glycogen molecules are synthesized, may indicate the likelihood of dark-cutting beef because, theoretically, the expression of glycogenin would correlate with the number of glycogen molecules (Shearer et al., 2000Go).

Several studies have established that muscle satellite cells contribute to postnatal muscle growth by providing nuclei to the growing fiber (Powell and Aberle, 1975Go; Swatland, 1977Go; Trenkle et al., 1978Go). Therefore, an in vitro model using bovine satellite cells was evaluated to determine how exposure to {alpha}-LA affected LPL and glycogenin mRNA concentrations in cell culture. A numerical increase in mRNA concentrations for LPL was observed with 10 nM {alpha}-LA compared to the control. There was an increase at 1 µM {alpha}-LA compared with the control for the expression of glycogenin. This is inconsistent with results from the in vivo experiment where there was no change in expression of glycogenin in the steers fed flaxseed. The differing results may be attributed to the fact that in the in vivo experiment, ground flaxseed was the {alpha}-LA source, whereas in the in vitro experiment, a pure source of {alpha}-LA was used. In the cell culture model, it is possible that PUFA were directly incorporated into the plasma membrane, thereby increasing membrane fluidity. Increasing membrane fluidity may allow for increased glucose transport protein-4 (GLUT-4) content (Kato et al., 2000Go; Taouis et al., 2002Go) and ultimately increase the uptake of glucose, causing the formation of additional glycogenin to store the excess glucose as glycogen. However, the {alpha}-LA may not have escaped biohydrogenation in the ruminant, and excess glucose in the cells may not have been available; consequently, a difference was not found for the mRNA concentration from glycogenin in flaxseed-fed steers. Even though it is thought that the some {alpha}-LA of ground flaxseed escapes biohydrogenation (LaBrune, 2000Go), Scollan et al. (2001)Go reported that steers fed whole linseed had higher levels of {alpha}-LA in both the neutral and phospholipid fractions of LM tissue. This would suggest that grinding the linseed decreases the natural protection provided by the hull.

In addition to being high in {alpha}-LA content, flaxseed is a rich source of the plant lignan, secoisolariciresinol diglycoside (Thompson, 1995Go). In the presence of secoisolariciresinol diglycoside, bacteria in the colon synthesize two mammalian lignans, enterolactone and enterodiol. These two lignans target the liver, and the liver is understood to be the primary source of circulating IGF-I (Rickard and Thompson, 1998Go). However, when 5% flaxseed was supplemented to rats, plasma IGF-I concentrations were decreased compared with the unsupplemented controls (Rickard et al., 2000Go). Thus, it seems that the lignan component of flaxseed may also decrease IGF-I concentrations in cattle (Dunn et al., 2003Go), which also could decrease the availability of excess glucose to signal the need for glycogenin in the steers.

Chilliard (1992)Go summarized in vitro adipose tissue experiments, and concluded that fatty acid synthesis is more sensitive to inhibition by saturated fats than unsaturated fats. This could be an explanation of why fatty acid availability is enhanced in ruminant adipocytes, allowing for increased marbling in carcasses from steers fed flaxseed. Furthermore, Taouis et al. (2002)Go determined that GLUT-4 content was maintained in Wistar rats that received a high-fat diet containing PUFA (n-3) compared with controls that received a low-fat diet. This research (Taouis et al., 2002Go) supports the theory that when a high-fat diet is fed that glucose uptake should remain at least at normal levels or increase supporting the formation of glycogen and production of glycogenin, as well as the possibility for excess energy metabolized into intramuscular adipose tissue.

To our knowledge, glycogenin has not been examined in bovine skeletal muscles or satellite cells, but LPL has been evaluated to some extent in muscle. These two molecules are an intricate part of energy metabolism; however, from the current results, it is not possible to determine whether the changes observed in LPL and glycogenin mRNA concentrations from the combination of feeding flaxseed and implanting with Revalor-S is responsible for the previously observed increase in marbling from feeding flaxseed (LaBrune, 2000Go). For this experiment, the goal was to determine the effects of the treatments on the first phase of finishing steers. Future studies that examine the effects of feeding flaxseed and implanting should follow these steers through the finishing period and provide carcass data.

Implications

The concentrations of messenger RNA for genes associated with multiple aspects of beef quality were not modified by a growth-promoting implant. Feeding flaxseed for 28 d decreased expression of lipoprotein lipase and glycogenin in muscle, suggesting that lipoprotein lipase was partitioning fatty acids to adipose tissues. These findings contribute to our understanding of the factors that may regulate beef carcass quality and the role of feeding flaxseed in increased marbling scores, which could affect beef carcass quality grade.

Footnotes

1 Contribution No. 04-064-J from the Kansas Agric. Exp. Stn., Manhattan. Back

2 Correspondence: 126 Call Hall (phone: 785-532-3476; fax: 785-532-5681; e-mail: bjohnson{at}ksu.edu).

Received for publication August 25, 2003. Accepted for publication February 25, 2004.

Literature Cited



Adamo, K. B., and T. E. Graham. 1998. Comparison of traditional measurements with macroglycogen and proglycogen analysis of muscle glycogen. J. Appl. Physiol. 84:908–913.[Abstract/Free Full Text]

Alonso, M. D., J. Lomako, W. M. Lomako, and W. J. Whelan. 1995. A new look at the biogenesis of glycogen. J. FASEB. 9:1126–1137.[Abstract]

Bergamini, E. 1975. Different mechanisms in testosterone action on glycogen metabolism in rat perineal and skeletal muscles. Endocrinology 96:77–84.[Abstract/Free Full Text]

Chilliard, Y. 1992. Dietary fat and adipose tissue metabolism in ruminants, pigs, and rodents: A review. J. Dairy Sci. 76:3897–3931.

Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156–159.[Medline]

Cianzio, D. S., D. G. Topel, G. B. Whitehurst, D. C. Beitz, and H. L. Self. 1985. Adipose tissue growth and cellularity changes in bovine adipocyte size and number. J. Anim. Sci. 60:970–976.

Derave, W., S. Gao, and E. A. Richter. 2000. Pro- and macroglycogenolysis in contracting rat skeletal muscle. Acta Physiol. Scand. 169:291–296.[Medline]

Doreau, M., and A. Ferlay. 1994. Digestion and utilisation of fatty acids by ruminants. Anim. Feed Sci. Technol. 45:379–396.

Dunn, J. D., B. J. Johnson, J. P. Kayser, A. T. Waylan, E. K. Sissom, and J. S. Drouillard. 2003. Effects of flax supplementation and a combined trenbolone acetate and estradiol implant on circulating insulin-like growth factor-I (IGF-I) and muscle IGF-I messenger RNA levels in beef cattle. J. Anim. Sci. 81:3028–3034.[Abstract/Free Full Text]

Ekeren, P. A., D. R. Smith, D. K. Lunt, and S. B. Smith. 1992. Ruminal biohydrogenation of fatty acids from high-oleate sunflower seeds. J. Anim. Sci. 70:2574–2580.[Abstract]

Frey, R. S., B. J. Johnson, M. R. Hathaway, M. E. White, and W. R. Dayton. 1995. Growth factor responsiveness of primary satellite cell cultures from steers implanted with trenbolone acetate and estradiol-17ß. Basic Appl. Myology 5:71–79

Goldberg, I. J., and M. Merkel. 2001. Liprotein lipase: Physiology, biochemistry, and molecular biology. Front. Biosci. 6:D388–D405.[Medline]

Hermesmeyer, G. N., L. L. Berger, T. G. Nash, and R. T. Brandt, Jr. 2000. Effects of energy intake, implantation, and subcutaneous fat end point on feedlot steer performance and carcass composition. J. Anim. Sci. 78:825–831.[Abstract/Free Full Text]

Hocquette, J. F., B. Graulet, and T. Olivecrona. 1998. Lipoprotein lipase activity and mRNA levels in bovine tissues. Comp. Biochem. Physiol. 121(B):201–212.

Hocquette, J. F., B. Graulet, M. Vermorel, and D. Bauchart. 2001. Weaning affects lipoprotein lipase activity and gene expression in adipose tissues and in masseter but not in other muscles of the calf. Brit. J. Nutr. 86:433–441.[Medline]

Johnson, B. J., P. T. Anderson, J. C. Meiske, and W. R. Dayton. 1996a. Effect of a combined trenbolone acetate and estradiol implant on feedlot performance, carcass characteristics, and carcass composition of feedlot steers. J. Anim. Sci. 74:363–371.[Abstract/Free Full Text]

Johnson, B. J., N. Halstead, M. E. White, M. R. Hathaway, A. DiCostanzo, and W. R. Dayton. 1998. Activation state of muscle satellite cells isolated from steers implanted with a combined trenbolone acetate and estradiol implant. J. Anim. Sci. 76:2779–2786.[Abstract/Free Full Text]

Johnson, B. J., M. R. Hathaway, P. T. Anderson, J. C. Meiske, and W. R. Dayton. 1996b. Stimulation of circulating insulin-like growth factor-I (IGF-I) and insulin-like growth factor binding proteins (IGFBP) due to administration of a combined trenbolone acetate and estradiol implant in feedlot cattle. J. Anim. Sci. 74:372–379.[Abstract/Free Full Text]

Kato, M., T. Miura, M. Nakao, N. Iwamoto, T. Ishida, and K. Tanigawa. 2000. Effect of alpha-linolenic acid on blood gucose, insulin and GLUT4 content of Type 2 diabetic mice. J. Health Sci. 46:489–492.

LaBrune, H. J. 2000. The effects of grain processing and lipid addition on blood glucose, performance, carcass characteristics, and meat quality in finishing cattle. M.S. Thesis, Kansas State Univ., Manhattan.

Powell, S. E., and E. D. Aberle. 1975. Cellular growth of skeletal muscle in swine differing in muscularity. J. Anim. Sci. 40:476–485.[Abstract/Free Full Text]

Rickard, S. E., and L. U. Thompson. 1998. Chronic exposure to secoisolariciresionol diglycoside alters lignan disposition in rats. J. Nutr. 128:615–623.[Abstract/Free Full Text]

Rickard, S. E., Y. V. Yuan, and L. U. Thompson. 2000. Plasma insulin-like growth factor I levels in rats are reduced by dietary supplementation of flaxseed or its lignan secoisolariciresinol diglycoside. Cancer Lett. 161:47–55.[Medline]

Scanga, J. A., K. E. Belk, J. D. Tatum, T. Grandin, and G. C. Smith. 2001. Factors contributing to the incidence of dark cutting beef. Available: http://www.grandin.com/references/dark.cutters.html. Accessed Nov. 4, 2001.

Schmidt, T. B., D. L. Roeber, P. K. Bates, D. R. McKenna, T. G. Field, T. H. Montgomery, J. B. Morgan, J. W. Savell, and G. C. Smith. 2001. National beef quality audit-2000: consensus of the beef industry. J. Anim. Sci. 79(Suppl. 1):63. (Abstr.)

Scollan, N. D., N. J. Choi, E. Kurt, A. V. Fisher, M. Enser, and J. D. Wood. 2001. Manipulating the fatty acid composition of muscle and adipose tissue in beef cattle. Br. J. Nutr. 85:115–124.[Medline]

Semenkovich, C. F., S. H. Chen, M. Wims, C. C. Luo, W. H. Li, and L. Chan. 1989. Lipoprotein lipase and hepatic lipase mRNA tissue specific expression, developmental regulation, and evolution. J. Lipid Res. 30:423–431.[Abstract]

Shearer, J., I. Marchand, P. Sathasivam, M. A. Tarnopolsky, and T. E. Graham. 2000. Glycogenin activity in human skeletal muscle is proportional to muscle glycogen concentration. Am. J. Physiol. 278:E177–E180.

Smythe, C., P. Watt, and P. Cohen. 1990. Further studies on the role of glycogenin in glycogen biogenesis. Eur. J. Biochem. 189:199–204.[Medline]

Swatland, H. J. 1977. Accumulation of myofiber nuclei in pigs with normal and arrested development. J. Anim. Sci. 44:759–764.

Taouis, M., C. Dagou, C. Ster, G. Durand, M. Pinault, and J. Delarue. 2002. N-3 Polyunsaturated fatty acids prevent the defect of insulin receptor signaling in muscle. Am. J. Physiol. 282:E664–-E671.

Thompson, L. U. 1995. Flaxseed, lignans, and cancer. Pages 219–236 in Flaxseed in Human Nutrition. S. C. Cunnane, and L. U. Thompson, ed. AOCS Press, Champaign, IL.

Trenkle, A., D. L. DeWitt, and D. G. Topel. 1978. Influence of age, nutrition and genotype on carcass traits and cellular development of M. longissimus of cattle. J. Anim. Sci. 46:1597–1603.[Abstract/Free Full Text]


This article has been cited by other articles:


Home page
J ANIM SCIHome page
B. W. Hess, G. E. Moss, and D. C. Rule
A decade of developments in the area of fat supplementation research with beef cattle and sheep
J Anim Sci, April 1, 2008; 86(14_suppl): E188 - E204.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Waylan, A. T.
Right arrow Articles by Sissom, E. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Waylan, A. T.
Right arrow Articles by Sissom, E. K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS