J. Anim Sci.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moeller, S. J.
Right arrow Articles by Irvin, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moeller, S. J.
Right arrow Articles by Irvin, K. M.
J. Anim. Sci. 2003. 81:402-410
© 2003 American Society of Animal Science

Rendement Napole gene effects and a comparison of glycolytic potentialand DNA genotyping for classification of Rendement Napole status in Hampshire-sired pigs1,2

S. J. Moeller*,3, T. J. Baas{dagger}, T. D. Leeds*, R. S. Emnett{ddagger} and K. M. Irvin*

* The Ohio State University, Columbus 43210; and {dagger} Iowa State University, Ames 50011;and {ddagger} PIC, USA, Franklin, KY 42135


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Implications
 Literature Cited
 
The purpose of the present study was to compare Rendement Napole (RN) classification from glycolytic potential (GP) and DNA techniques, and to study the effect of the RN gene on performance, carcass, muscle quality, and sensory traits. Progeny (N = 118) from the mating of 15 purebred Hampshire sires to York x Landrace females were classified for RN gene status using the GP of the loin and polymerase chain reaction-restriction fragment length polymorphism sequence methodology. Females mated in the study (N = 32) were considered normal (rn+/rn+) based on a loin GP measurement taken on samples collected by live press biopsy. Progeny were randomly selected for harvest within a litter for each sire. Observed mean, standard deviation, and range of progeny loin GP values were 132.2, 30.7, and 70.0 to 193.0 µmol/g, respectively. The GP data were not normally distributed. Peak numbers of observations occurred between 120 and 129 µmol/g and 160 to 169 µmol/g. Pigs with a loin GP of >150 µmol/g were classified RN/rn+ based on the observed valley between the peak values, resulting in 37 pigs classified as RN/rn+ and 81 pigs classified as rn+/rn+. Using DNA procedures, 81 RN/rn+ and 37 rn+/rn+ pigs were observed. All classification errors occurred when GP values were ≤150 µmol/g, with 30 of 44 and 14 of 44 classification errors occurring when loin GP values were between 121 and 150 µmol/g and 70 and 120 µmol/g, respectively. Gene effects, based on DNA results, were evaluated using mixed-model procedures with fixed effects of DNA genotype and gender, and random sire and litter effects. No RN genotype differences for growth rate, 10th-rib backfat, or loin muscle area were observed. Loins from the RN/rn+ pigs had significantly (P < 0.05) lower ultimate pH (0.16 units), greater GP (50.3 µmol/g), greater drip loss (0.93%), paler objective color (L*, 1.66 units), paler visual color (0.31 units), and lower firmness (0.61 units) scores. Additionally, loins from RN/rn+ pigs had significantly (P < 0.05) lower marbling scores (0.68 units) and intramuscular fat content (0.25%) and greater cooking loss (2.51%). Cooked moisture, juiciness score, and mechanical and sensory tenderness measures did not differ between genotypes. The GP-based classification did not correctly classify RN genotype in the present study, emphasizing the importance of the direct DNA analysis for estimation of gene frequency and effects. The DNA-based genotype results clearly indicate the RN allele has negative effects on muscle quality measures.

Key Words: Genotype • Meat Quality • Muscles • Pig


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Implications
 Literature Cited
 
The presence of the Rendement Napole (RN) gene in swine of Hampshire descent and the impact of the gene upon fresh and processed pork quality attributes has been demonstrated by a number of researchers (Le Roy et al., 1990Go; Lundstrom et al., 1996Go; Enfalt et al., 1997aGo,bGo). Each has used the bimodal distribution of glycolytic potential as described by Monin and Sellier (1985)Go to test for the presence and effects of the mutant RN gene. Milan et al. (2000)Go described the causative mutation for the RN allele, allowing for direct genotype assessment and further investigation of the effect of the RN mutation in swine populations.

The economic importance of production efficiency, carcass merit, and muscle quality to the swine industry has resulted in the need to better understand the impact of newly discovered genes on these traits. Prior to the discovery of the causative mutation and availability of DNA analysis techniques, researchers investigating the RN gene in swine relied on an indirect method to determine RN genotype based on a measure of glycolytic potential (GP) of the muscle. With the advent of DNA testing procedures, the opportunity to evaluate the efficacy of the GP procedure for genotype assessment and the ability to more closely evaluate the impact of the causative RN mutation on the economically important traits are now possible. The objectives of this research were: 1) to evaluate the frequency of the mutant RN allele in a Hampshire-sired population, 2) to utilize Hampshire-sired progeny to compare RN genotype classification based on the indirect GP and direct DNA genotype techniques, and 3) to assess the impact of the mutant RN allele on growth, carcass, muscle quality, and sensory attributes of pigs and pig meat using DNA genotype results.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Implications
 Literature Cited
 
Animals

Matings of Yorkshire x Landrace F1 crossbred females were conducted by AI using semen from 15 unrelated purebred Hampshire sires of unknown RN gene status. Rendement Napole gene classification in females was based on the GP of a loin muscle sample collected at market weight using a live-animal biopsy procedure described by Lahucky and Kovac (1990)Go. The live biopsy procedure involved crowding the female into a corner of the pen followed by washing the biopsy target area with warm soap and water. Hair was clipped from the biopsy area and the skin scrubbed with Betadine solution followed by a 70% alcohol rinse. A topical anesthetic (Catecaine) was sprayed on the prepared surface. Following the biopsy, a local anesthetic (Catecaine) and an antiseptic ointment (Furacin) was administered to the biopsy incision area. Pigs were observed closely following the biopsy for signs of abnormal behavior or infection at the incision site. The distribution of GP values for the female population was observed to be bimodal and only females with loin GP values represented in the lower mode (<207 µmol/g) were considered for mating. The females represented in the lower mode were classified as noncarriers (rn+/rn+) for the RN gene using methods described by Le Roy et al. (1990)Go and Lundstrom et al. (1996)Go. A total of 32 litters, representing one to three litters per sire and three to 24 pigs per sire, were produced within the breeding period and used in the present study.

Pigs were housed in a mechanically ventilated, curtain-sided finishing building with fully slotted floors and were allowed 0.77 m2 of floor space each in pens of either 20 or 25 pigs from 33 kg until they were marketed at an average weight of 118.6 kg. A 17.5% CP, 1.15% lysine corn-soy diet was provided ad libitum from 33 to 68 kg, followed by a 16.0% CP, 0.85% lysine corn-soy diet from 68 to 91 kg, and a 15.0% CP, 0.70% lysine corn-soy diet from 91 kg to market weight. Pigs were weighed and transported to a commercial swine abattoir and rested approximately 8 h prior to stunning and exsanguination. Four harvest events occurred in the trial.

Progeny were randomly selected for harvest on a within-litter basis for each sire with a goal of testing a minimum of eight progeny per sire and two or three pigs per litter. Eight progeny from each sire were selected to attempt to keep the probability of failing to detect the mutant RN allele low (P = 0.0039) if all progeny were normal (rn+/rn+). Due to variable conception rates and litter size, sire progeny groups included as few as three pigs and one litter per sire, and as many as 11 pigs from four litters per sire.

Carcass Measurements

At 24 h postmortem, the right side of the carcass was ribbed between the 10th and 11th ribs for collection of 10th-rib loin muscle area and backfat depth (NPPC, 1991Go). Dorsal midline backfat measurements were collected at the last rib and last lumbar locations. A section of loin muscle encompassing the 10th- to 11th-rib interface through the 14th- to 15th-rib interface was removed from the hanging carcass and transported to the Iowa State University Meat Laboratory for muscle quality assessment.

Muscle Quality Assessment Procedures

At 36 to 48 h postmortem, the loin section was deboned and cut into four 2.5-cm-thick loin chops. After a 10-min bloom, subjective color, marbling, and firmness/wetness scores were taken on the anterior loin chop following guidelines described in Procedures to Evaluate Market Hogs (NPPC, 1991Go). Loin muscle color (L*) was objectively measured on the 11th- to 12th-rib loin surface by using the CR-310 Minolta Chroma Meter (Minolta Corp., Ramsey, NJ) fitted with a 50-mm diameter orifice using a D65 illuminant standardized against a white tile. Ultimate pH was measured with a portable pH meter (pH Star, SFK Co., Cedar Rapids, IA). Drip loss was measured using a filter-paper technique (Kauffman et al., 1986Go) on the opposing fresh cut face of the anterior loin section after a 10-min bloom.

The anterior loin section was homogenized for estimation of intramuscular fat using the total lipid extraction procedure outlined by Folch et al. (1957)Go. The second loin section was frozen and transported to The Ohio State University for GP determination. Frozen samples were homogenized in 10 mL of 0.5 M perchloric acid. Glycolytic potential was determined following the procedures described by Monin and Sellier (1985)Go, where GP = 2([glycogen] + [glucose] + [glucose-6-phosphate]) + [lactate]. The GP values were assessed in duplicate with the average of the two measures expressed as micromoles of lactate equivalent per gram (µmol/g) of fresh tissue.

Sensory Analysis Procedures

Two loin sections, encompassing approximately the 12th- to 13th- and 13th- to 14th-rib locations within the thoracic region, were vacuum packaged and stored for 7 to 10 d at temperatures between 0 and 4°C before sensory evaluation. Purge loss during storage was measured as the difference between the weights of the vacuum packaged loin prior to and after removal of the chop and was expressed on a percentage basis. Both loin chops were cooked simultaneously to an internal temperature of 71°C in an electric oven broiler (Amana ARE 640, Amana Refrigeration Inc., Amana, Iowa). Individual chop temperatures were monitored using thermocouples (Chromega/Alomega, 0.2 mm diameter, 1.8 m length, Omega Engineering Inc., Stamford, CT). Weighing chops before and after cooking determined cooking loss percentage. An objective, instrumental measure of Instron tenderness was evaluated on one cooked chop per pig by using a circular, five-pointed star probe attached to an Instron Universal Testing Machine (model 4502, Instron Corp., Canton, MA). The star probe diameter was 9 mm, with 6 mm between each point. The angle from the end of each point to the center was 48°. A 100-kg load cell was used with a crosshead speed of 200 mm/min. The measure of tenderness was the amount of force (kg) required to puncture and compress the chop to 80% of sample height. Values reported are the mean of three observations per chop.

Sensory traits were measured using a three-member trained panel. Three 1.3-cm cubes were removed from the center of the broiled loin chop and served. The pork cubes were served under red lights to panelists who were seated individually and separated by visual barriers. Panelists were served a single cube of pork per pig and samples were evaluated on a 10-point, end-anchored scale for each trait. Traits evaluated included juiciness (1 = dry and 10 = juicy), tenderness (1 = tough and 10 = tender), chewiness (1 = not chewy and 10 = very chewy), pork flavor (1 = none and 10 = intense), and off-flavor (1 = none and 10 = intense). Between samples, deionized distilled water and unsalted crackers were served to cleanse the palate.

Genotype Classification

The distribution of loin GP values in the progeny indicated a non-normal distribution with the peak number of observations occurring between 120 and 129 µmol/g and 160 to 169 µmol/g. Pigs with loin GP of >150 µmol/g were classified RN/rn+ based on the observed valley between the peak values. Pigs with loin GP values of ≤150 µmol/g were classified as rn+/rn+.

A PCR-RFLP test to determine direct Napole genotype was designed using sequence information available in GenBank (accession No. AF214521). Genomic DNA was isolated from 600 mg of loin tissue following the protocol outlined by Strauss (1998)Go. The PCR primers (forward 5'GAGGCCCAAATAAGTCAATGTA 3' and reverse 5' ACCGGGGTCAAATGCTC 3') were designed to amplify a 616-bp region, including the R200Q nonconservative substitution in the cystathionine β-synthase-1 domain of the PRKAG3 isoform of the regulatory {gamma} subunit of adenosine 5'-monophosphate-activated protein kinase (Milan et al., 2000Go). The PCR reactions were performed using 20 ng of porcine genomic DNA, 1.5 µL of PCR buffer (200 mM Tris-HCl, 500 mM KCl, and 50 mM MgCl2), 1.5 µL of deoxynucleotide triphosphates (dNTPs) (2 mM), 0.5 µL of forward and reverse primer (20 µM), 0.5 µL of Taq DNA polymerase (5 U/µL), and 10 µL of water. After an initial incubation period of 4 min at 94°C, the thermocycling profile was repeated 35 times under the following conditions: denaturation at 94°C for 45 s, annealing at 62°C for 1 min, and extension at 72°C for 1.5 min. A final incubation period of 5 min at 72°C followed by a hold at 4°C completed the amplification. Initial PCR amplification products were sequenced at the Plant-Microbe Genomics Facility at The Ohio State University for verification of the desired and specific amplification sequence. After PCR, 8 µL of the PCR product was digested with 0.25 µL of BsrBI restriction endonuclease (10 U/µL) in 1 µL of buffer (500 mM NaCl, 100 mM Tris-HCl, 100 mM MgCl2, and 10 mM dithiothreitol) and 0.75 µL of water. The nonconservative A/G nucleotide substitution introduces a restriction site in the sequence, thus permitting Napole genotype determination by separation of restriction fragments via agarose gel (1%) electrophoresis in 1x Tris-borate EDTA followed by ethidium bromide staining and visualization under UV light.

Statistical Analysis

Genotype data from DNA- and GP-based classification methods were analyzed using the mixed-model procedures of SAS (SAS Inst., Inc., Cary, NC) for performance, carcass, quality, and sensory traits measured. Fixed effects included in the model were gender and RN genotype, with sire and litter included as random effects. Date of harvest was included as a fixed effect for all muscle quality measures. A linear covariate for live market weight was used to standardize carcass data for weight variation. Growth rate was adjusted to a constant starting weight of 36 kg using guidelines recommended by the National Swine Improvement Federation (1997). Residual correlations among traits were estimated by using the MANOVA statement found in the GLM procedure of SAS. Two models were used to estimate the effect of the RN allele on associations among traits. The first model included the fixed effects of gender, RN genotype, and harvest date, and random effects of sire and litter. In the second model the effect of RN genotype was removed.


    Results and Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Implications
 Literature Cited
 
Napole Gene Frequency

Observed mean, standard deviation, and range of progeny loin GP values were 132.2, 30.7, and 70.0 to 193.0 µmol/g, respectively. The distribution of postmortem loin glycolytic potential (GP) from progeny testing is depicted in Figure 1Go. The population distribution deviated from normality and did not indicate clear bi-modality as has been described in previous research by Enfalt et al. (1997a)Go and Sutton (1997)Go. Using the available distribution, a GP value of 150 µmol/g was established as the truncation point for indirect classification of RN genotype by GP. The 150-µmol/g truncation level represented a point in the distribution where two consecutive GP observations differed by five µmol/g, which was the largest distance between two consecutive GP observations in the data set and at a point nearly intermediate between the observed peak frequencies of observations. Pigs with postmortem loin GP values of >150 µmol/g (N = 37) were classified as monomutant carriers (RN/rn+) and those with loin GP values ≤150 µmol/g (N = 81) were classified as nonmutants (rn+/rn+).


Figure 1
View larger version (28K):
[in this window]
[in a new window]

 
Figure 1. Distribution of observations (RN/rn+ = number of pigs within GP category based on DNA genotyping; rn+/rn+ = number of pigs within GP category based on DNA genotyping; GP observations = number of pigs within GP category) for pork loin glycolytic potential (GP) (µmol/g) within 10-unit increments, Rendement Napole (RN) genotype classification by GP, and RN genotype classification by DNA analysis from pigs of Hampshire by York-Landrace descent.

 
Genotype assessment derived from the PCR-RFLP tests identified 81 RN/rn+ and 37 rn+/rn+ progeny. When compared with GP, DNA analysis identified an additional 44 RN/rn+ pigs. All 37 pigs identified as RN/rn+ by GP (GP > 150 µmol/g) were also RN/rn+ by DNA analysis, indicating all GP genotype classification errors occurred when GP values were ≤150 µmol/g. The discrepancy between DNA- and GP-based classification methods (Figure 1Go) appears to be related to the truncation point for GP-based classification and the inability of GP-based classification to accurately predict the RN genotype, even in the very low range of GP values observed in this study. Based on the results of the present study, the use of GP as an indicator of Napole gene status is not an accurate predictor of true Napole genotype. The authors hypothesize that many of the errors are the result of the lack of a clearly defined bimodal distribution of GP values in the present data set, which is in contrast to previous literature reports (Fernandez et al., 1992Go; Lundstrom et al., 1996Go), where distinct bimodality was observed and used as the basis for classification. In the present data, lowering the GP threshold by 20 µmol/g would have resulted in fewer false negative results, but would have introduced false positive errors with pigs classified as RN/rn+ by GP being genotyped rn+/rn+ by DNA. A recent report by Hamilton et al. (2002)Go reported GP-based assessment of Napole genotype to have an overall misclassification rate of 12.5%, with an 8.9 and 18.3% misclassification rate for postmortem and live animal-based GP procedures, respectively.

Baas et al. (1998)Go reported that across two large genetic studies, 35 and 19% of variation in ultimate pH was attributed to day of harvest. In the present study, day of harvest was significant for GP and ultimate pH of the loin. Variation in GP attributable to harvest date may have contributed to subsequent GP-based RN classification resulting in GP-based genotype classification errors. Although mean levels of GP were different by day of harvest, the standard deviation and range of GP values across harvest dates were similar and both RN/rn+ and rn+/rn+ genotypes based on GP were observed within each harvest date.

Based on the observation of only carrier and nonmutant genotypes, there is a high probability that the mutant RN allele was transmitted to the progeny through the Hampshire sires and not the dams. Miller (2001)Go, reported estimates of the frequency of the RN mutation in purebred Landrace and Yorkshire populations from a study of National Barrow Show progeny pigs. The results showed no RN/rn+ in Landrace and 1.3% RN/rn+ in Yorkshire progeny tested, indicating segregation of the RN allele in the U.S. Yorkshire population. Thus, there is a possibility, although remote, that the RN allele may have been transmitted via a female used in the study. The authors cannot definitively state the RN status of the females or sires used in the present study because DNA was not stored for direct genotype assessment, but do acknowledge the possibility of transmission of the mutant allele through the female population due to the indefinite classification of females for RN using GP-based genotyping. For the progeny used in the present study, the heterozygous genotype represented 68.6% of the observations. Assuming the mutant RN allele was inherited solely from the Hampshire sires, the haploid RN allele frequency is approximately 0.69. This estimate of RN allele frequency is slightly higher, but in the general range (0.61) of allele frequencies reported by Enfalt et al. (1997b)Go in a Swedish purebred Hampshire population and by Le Roy et al. (1990)Go (0.60) in a French Hampshire population based on GP classification. The results of the present study indicate the challenge and risk associated with the use of glycolytic potential as an indirect method to determine the frequency and effects of the RN allele on traits of economic importance. Given the significant use of GP as a selection tool for elimination of the mutant RN allele from breeding programs, future efforts should be directed toward utilization of DNA genotyping to avoid genotype classification errors.

Napole Effects on Performance, Carcass, Muscle Quality, and Sensory Attributes

Data in Table 1Go describe the results of analyses for traits evaluated in the present study. Growth rate was not different among genotypes, which is similar to findings reported by Enfalt et al. (1997b)Go in a Swedish Hampshire population, but in contrast to reports by Enfalt et al. (1997a)Go where pigs genotyped RN/rn+ grew faster and subsequently had fewer days on test. Carcass measurements of muscle and backfat were not different in the present study with the exception of midline last lumbar backfat depth, where rn+/rn+ pigs were leaner (P < 0.05). This is in contrast to reports by Lebret et al. (1999)Go, who reported larger loin muscle area in pigs genotyped RN/rn+ and RN/RN compared with the normal rn+/rn+ genotype. They hypothesized the increased loin muscle area for pigs with the mutant RN allele was due to an increase in diameter of the Type IIA and Type IIBr muscle fibers. Research by Enfalt et al. (1997a)Go indicated that RN carriers had greater graded lean meat percentage and a greater percentage of meat and bone in the back and ham than noncarriers, which is in contrast to the data reported in this study.


View this table:
[in this window]
[in a new window]

 
Table 1. Least squares means and standard errors for performance, carcass, muscle quality, and sensory attributes of pork loin from pigs of Rendement Napolecarrier (RN/rn+) and normal (rn+/rn+) genotypes by DNA genotyping
 
Measures of fresh muscle quality were significantly inferior for the RN/rn+ progeny in this study. Visual and objective measures of loin color indicated the RN/rn+ genotype produced loins that were 0.31 subjective color units paler and 1.66 L* units paler than loins from rn+/rn+ pigs. It should be noted that the loin color for both genotypes was considered nearly ideal, with very few pale, soft, and exudative or dark, firm, and dry loins observed in the study. Paler color (L*) in RN/rn+ pigs agrees with larger internal reflectance values described by Enfalt et al. (1997b)Go and Lebret et al. (1999)Go and with greater Hunter L* values reported by Lundstrom et al. (1996)Go. Bidner et al. (1999b)Go observed greater Japanese color scores and lower Hunter L* values for the RN/rn+ genotype compared with the rn+/rn+ genotype, which is in contrast to the findings of the present study.

Loins from progeny with the RN allele had significantly lower ultimate pH values (5.53 vs 5.69), subsequent greater drip loss (2.78 vs 1.83%), and poorer visual firmness/wetness scores (2.73 vs 3.34 units) compared with the rn+/rn+ genotype. The differences between RN/rn+ and rn+/rn+ genotypes for ultimate pH agree with previous research reports (Monin and Sellier, 1985Go; Enfalt et al., 1997aGo,bGo; Bidner et al., 1999aGo). Lower firmness/wetness scores indicate the inability of the loin to maintain its normal shape and the presence of increased moisture on the loin surface.

Large, highly significant differences in the percentage cooking and purge loss for loins from the RN/rn+ genotype compared with the rn+/rn+ genotype (24.6 vs 22.1% and 7.0 vs 4.8%, respectively) did not have a subsequent negative effect on cooked moisture or sensory juiciness. It appears that the RN allele has positive effects on bound moisture levels in the muscle prior to death as all postmortem measures of water-holding capacity (drip loss, ultimate pH, and purge) and moisture (cooking loss) showed negative effects of the RN allele, yet cooked moisture loss was not different. Lundstrom et al. (1996)Go reported that after accounting for pH as a covariate in statistical analyses, drip loss and cooking loss were not different between the carrier and negative genotypes. Bidner et al. (1999a)Go reported improved juiciness scores in pork from the RN/rn+ genotype when evaluated by a trained taste panel.

Objective (Instron) and subjective (sensory score) measures of tenderness were not different between genotypes. Previous reports by Ellis et al. (1997)Go, Enfalt et al. (1997b)Go, and Bidner et al. (1999a)Go indicated improved Warner-Bratzler shear values for pigs of the RN/rn+ genotype. Bidner et al. (1999a)Go also reported improved tenderness scores for pork from pigs of the RN/rn+ genotype when evaluated by a trained taste panel, whereas Lundstrom et al. (1996)Go reported no differences in sensory tenderness scores among genotypes.

Flavor scores were significantly poorer for RN carriers in the present study. Off-flavor scores were quite high in this data set and the RN/rn+ pigs produced loins with significantly greater (5.67 vs 3.36) off-flavor scores. Sensory panelist comments (no statistical relationship evaluated) indicated a strong metallic taste to the pork served, which may be the result of the low ultimate pH. Lundstrom et al. (1996)Go reported similar findings, with pork from RN carriers having greater taste intensity, smell intensity, and acidity scores compared with pork from rn+/rn+ pigs.

Visual marbling scores and intramuscular fat percentages were significantly lower for loins from RN/rn+ pigs, with a difference of 0.35% intramuscular fat compared with loins from the rn+/rn+ genotype. The reduced intramuscular fat may have contributed to the lower flavor score (1.09 vs 1.43 units) observed for loins from RN/rn+ pigs. Bidner et al. (1999a)Go reported no genotype effect on intramuscular fat percentage in a study evaluating lysine content and time off-feed across RN genotypes.

Data from the present study were also evaluated using GP-based genotype classification and the same statistical analysis model as previously described for DNA-based genotypes. Results indicted significant differences between RN/rn+ and rn+/rn+ for loin ultimate pH, loin GP, and loin firmness score. Loins from the normal genotype had a greater ultimate pH, lower GP, and loin surfaces that were firmer with less exudate when compared with the heterozygote. No other differences were observed between GP-based genotypes.

Gender Effects

Differences between barrows and gilts are reported in data included in Table 2Go. Gilts grew significantly slower, had less backfat at all locations, and had longer carcasses and more 10th-rib loin muscle area compared with the contemporary barrows. The present results are similar to those reported in the National Pork Producers Council Terminal Line Program Results report (1995).


View this table:
[in this window]
[in a new window]

 
Table 2. Least squares means and standard errors for performance, carcass, muscle quality, and sensory attributes of pork loin from barrows and gilts
 
Ultimate pH, GP, and drip loss were not different between loins from barrows and gilts, but purge loss was significantly greater (1.29%) in loins from barrows. The increased purge loss in loins from barrows did not result in an observable difference in sensory measured juiciness among genders.

Objective Instron measurement of tenderness indicated no gender effect, but sensory measures of tenderness and chewiness indicated the pork loins from barrows were significantly more tender and less chewy compared with loins from gilts. Previous research (NPPC, 1995Go) showed loins from barrows required significantly less Instron pressure to compress a cooked chop to 80% of initial thickness and had improved tenderness scores with no difference in chewiness scores compared to loins from gilts.

Loins from barrows had significantly higher marbling score (2.89 vs 2.31) and more intramuscular fat within the loin (2.76 vs 1.90%) compared with loins from gilt carcasses. However, the increased intramuscular fat levels did not result in improved flavor or juiciness scores for the loins from barrows as might be hypothesized when fat amounts are increased.

Correlation Analyses

Residual correlations among traits prior to and after accounting for RN genotype effects in the model are summarized in Table 3Go. Accounting for RN genotype in the model clearly reduced correlations between traits related to loin water-holding capacity. Accounting for the RN genotype resulted in sizeable reductions in the correlation between ultimate pH and GP (r = –0.59 vs –0.34), drip loss (r = –0.43 vs –0.26), marbling score (r = 0.44 vs 0.32), firmness/wetness score (r = 0.37 vs 0.16 [NS]), cooking loss (r = –0.36 vs –0.20), purge loss (r = –0.27 vs –0.07 [NS]), flavor (r = 0.68 vs 0.57), and off-flavor score (r = –0.59 vs –0.39) when compared with the residual model with RN removed. However, this pattern did not hold true for measures of color (L* or visual color score), where accounting for RN in the model had very little or no impact on correlations with ultimate pH. These results indicate that the mutant RN allele has a large impact on traits commonly measured to assess water-holding capacity and sensory attributes, including flavor and off-flavor, of the pork loin, and agrees with the observed genotype differences presented in Table 1Go.


View this table:
[in this window]
[in a new window]

 
Table 3. Residual correlation coefficients among live pig growth rate, carcass measurements, loin muscle quality attributes, and loin sensory measuresa,b
 
When evaluating the relationship between GP and other traits, accounting for the RN genotype consistently reduced the correlation for all traits and in many cases the relationship was not significant in the model where RN genotype was removed. These findings would suggest that loin GP might not be a good indicator of muscle quality in populations where the mutant RN allele is not segregating. Similar reductions in the strength of relationships among drip loss and other quality attributes were observed.

Accounting for the RN genotype effects had little impact on the association between loin color (L*) and ultimate pH (r = –0.62 vs –0.59), cooked moisture (r = –0.28 vs –0.26), or juiciness score (r = –0.31 vs –0.30), but did reduce the correlation between loin L* and marbling score (r = –0.26 vs –0.19 [NS]), firmness (r = –0.36 vs –0.28), flavor score (r = –0.44 vs –0.37), and off-flavor score (r = 0.31 vs 0.20 [NS]) compared with the model with RN genotype removed.

Ultimate pH was correlated with GP (r = –0.59) in the reduced model as expected because GP is a measurement of the amount of glucose and lactate present in the muscle sample, and greater GP values are indicative of greater lactate concentrations in the muscle that can result in a lower ultimate pH value. Ultimate pH was also highly correlated with visual color (r = 0.53) and objective color measurements (L*, r = –0.59), indicating that loins with a greater pH were associated with darker visual and objective measures of loin color.

Pork flavor and off-flavor scores were favorably associated with higher ultimate pH in the loin, with correlations of 0.68 and –0.59, respectively, indicating loins with a greater pH have a tendency to be more flavorful with fewer negative off-flavors. Moderate correlations were also found between flavor and color measurements, with the relationship between L* and flavor score being negative (r = –0.44), and the relationship between visual color and flavor being positive (r = 0.46). These results indicate that paler loin color as measured visually and objectively may result in poorer flavor in the cooked loin, a relationship that is consistent after adjusting for RN genotype.

Instron tenderness was found to be correlated with cooking loss (r = 0.28), purge loss (r = 0.29), chewiness (r = 0.44), and subjective tenderness score (r = –0.36), indicating greater Instron measurements are associated with more cooking and purge loss, as well as chewier and less tender pork loin. These relationships were consistent across models used to estimate the correlations.

Miller et al. (1998)Go reported similar relationships between quality and sensory traits with correlations between muscle GP value and L*, drip loss, ultimate pH, and cooking loss of 0.32, 0.43, –0.49, and 0.34, respectively, in a study involving live biopsy data collected from pigs with RN/rn+ and rn+/rn+ genotypes.

The relationships described in this study suggest that lower ultimate pH of the loin, independent of gender and genotype effects, will result in pork with compromised water-holding capacity in the form of increased drip and purge losses, and greater moisture loss in the cooked product. Conversely, higher ultimate pH of the loin is related to enhanced tenderness and juiciness, improved flavor, and darker color in the present study. As indicated by the reduction in magnitude of the correlations after accounting for RN genotype in the model, the use of ultimate pH as an indicator of subsequent measures of water holding capacity must be evaluated within the context of RN genotype status.


    Implications
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Implications
 Literature Cited
 
The results of the present study indicate that the use of glycolytic potential to assess the presence of the Rendement Napole mutation is inferior to molecular-based genotyping and indicate the need to reassess the influence of genotype effects derived from glycolytic potential classification methods. The error rate for genotype classification using glycolytic potential in the present study seems to be a function of the subjectivity involved in establishing the cut-off value for classification and the inability of glycolytic potential to correctly identify Napole carriers at the lower end of the distribution. The negative effect of the mutant Napole allele on loin color, water-holding capacity, and firmness traits, along with a more intense off-flavor, indicate that the mutant allele has negative effects on processing capabilities and consumer acceptance traits of pork. These data support selection to remove the mutant Napole allele from pig populations where quality pork is desired.


    Footnotes
 
1 Salaries and research support provided by state and federal funds appropriated by the Ohio Agric. Res. and Dev. Center, The Ohio State Univ., manuscript No. 17-02AS. Back

2 Partial financial support for this project provided by the National Swine Registry and Hampshire Swine Registry, West Lafayette, IN. Back

3 Correspondence:
122 Animal Science Bldg., 2029 Fyffe Rd. (phone: 614-688-3686; fax: 614-292-3513; E-mail:
moeller.29{at}osu.edu).

Received for publication May 2, 2002. Accepted for publication November 8, 2002.


    Literature Cited
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Implications
 Literature Cited
 


Baas, T. J., R. N. Goodwin, and L. L. Christian. 1998. Effect of slaughter date on muscle quality of pork carcasses. J. Anim. Sci. 76(Suppl. 1):48. (Abstr.)[Abstract/Free Full Text]

Bidner, B. S., M. Ellis, K. D. Miller, M. Hemann, D. Campion, and F. K. McKeith. 1999a. Effect of the RN gene and feed withdrawal prior to slaughter on fresh longissimus quality and sensory characteristics. J. Anim. Sci.77(Suppl. 1):49 (Abstr).

Bidner, B. S., M. Ellis, D. P. White, M. England, D. Campion, and F. K. McKeith. 1999b. Effect of the RN gene, feed withdrawal, and lysine deficient diet on fresh longissimus quality. J. Anim. Sci.77(Suppl. 1):49. (Abstr.)

Ellis, M., F. K. McKeith, and D. S. Sutton. 1997. Effects of the Napole gene on quality. Pages 49–58 in Proc. Natl. Pork Producers Counc. Pork Quality Summit, Des Moines, IA.

Enfalt, A. C., K. Lundstrom, I. Hansson, S. Johansen, and P. Nystrom. 1997a. Comparison of non-carriers and heterozygous carriers of the RN-allele for carcass composition, muscle distribution, and technological meat quality in Hampshire-sired pigs. Livest. Prod. Sci.47:221–229.

Enfalt, A. C., K. Lundstrom, A. Karlsson, and I. Hansson. 1997b. Estimated frequency of the RN-allele in Swedish Hampshire pigs and comparisons of glycolytic potential, carcass composition, and technological meat quality among Swedish Hampshire, Landrace and Yorkshire pigs. J. Anim. Sci.75:2924–2935.[Abstract/Free Full Text]

Fernandez, X., E. Tornberg, J. Naveau, A. Talmant, and G. Monin. 1992. Bimodal distribution of muscle glycolytic potential in French and Swedish populations of Hampshire crossbred pigs. J. Sci. Food Agric.59:307–311.

Folch, J., M. Lees, and G. H. Stanley. 1957. A simple method for the isolation and purification of lipids from animal tissues. J. Biol. Chem.226:497–504.[Free Full Text]

Hamilton, D. N., M. Ellis, K. D. Miller, F. K. McKeith, and A. D. Higgerson. 2002. Comparison of the glycolytic potential and DNA-based test for predicting Rendement Napole genotype. J. Anim. Sci. 80(Suppl 2):80. (Abstr.)

Kauffman, R. G., G. Eikelenboom, P. G. van der Wal, G. Markus, and M. Zaar. 1986. The use of filter paper to estimate drip loss of porcine musculature. Meat Sci.18:191–200.

Lahucky, R., and L. Kovac. 1990. Use of biopsy to evaluate muscle quality in pigs. Pages 26–45 in Record of Proc. N. Amer. Swine Improvement Conf., Des Moines, IA.

Lebret, B., P. Le Roy, G. Monin, L. Lefaucheur, J. C. Caritex, A. Talmant, J. M. Elsen, and P. Sellier. 1999. Influence of three RN genotypes on chemical composition, enzyme activities, and myofiber characteristics of porcine skeletal muscle. J. Anim. Sci.77:1482–1489.[Abstract/Free Full Text]

Le Roy, P., J. Naveau, J. M. Elsen, and P. Sellier. 1990. Evidence for a new major gene influencing meat quality in pigs. Genet. Res. (Camb.)55:33–40.[Medline]

Lundstrom, K., A. Andersson, and I. Hansson. 1996. Effects of the RN gene on technological and sensory meat quality traits in crossbred pigs with Hampshire as terminal sire. Meat Sci.42:145–153.

Milan, D., J. T. Jeon, C. Looft, V. Amarger, A. Robic, M. Thelander, C. Rogel-Gaillard, S. Paul, N. Iannuccelli, L. Rask, H. Ronne, K. Lundstrom, N. Reinsch, J. Gellin, E. Kalm, P. Le Roy, P. Chardon, and L. Andersson. 2000. A mutation in PRKAG3 associated with excess glycogen content in pig skeletal muscle. Science288:1248–1251.[Abstract/Free Full Text]

Miller, M. 2001. Napole’s time is up. Pork Magazine 21:20–21.

Miller, K. D., M. Ellis, F. K. McKeith, and E. R. Wilson. 1998. Regression relationships between longissimus glycolytic potential and growth performance, carcass and meat quality characteristics. J. Anim. Sci.76(Suppl. 1):148. (Abstr.)

Monin, G., and P. Sellier. 1985. Pork of low technological meat quality with a normal rate of muscle pH fall in the immediate post mortem period. The case of the Hampshire pigs. Meat Sci.13:49–63.

NPPC. 1991. Procedures to Evaluate Market Hogs. 3rd ed. Natl. Pork Producers Counc., Des Moines, IA.

NPPC. 1995. Terminal Line Program Results. Natl. Pork Producers Counc., Des Moines, IA.

NSIF. 1997. Guidelines For Uniform Swine Improvement Programs. Natl. Swine Improv. Fed. Available: www.nsif.com. Accessed Dec. 16, 2002.

Strauss, W. M. 1998. Preparation of Genomic DNA from Mammalian Tissue. Page 1–3 in Current Protocols in Molecular Biology. Vol. 1. John Wiley & Sons, Inc., New York.

Sutton, D. S. 1997. The meat quality and processing characteristics of RN carrier and non-carrier pigs. Ph.D. Thesis, Univ. of Illinois, Urbana.


This article has been cited by other articles:


Home page
Professional Animal ScientistHome page
C. C. Carr, D. J. Newman, G. K. Rentfrow, D. H. Keisler, and E. P. Berg
Effects of Slaughter Date, On-Farm Handling, Transport Stocking Density, and Time in Lairage on Digestive Tract Temperature, Serum Cortisol Concentrations, and Pork Lean Quality of Market Hogs
Professional Animal Scientist, June 1, 2008; 24(3): 208 - 218.
[Abstract] [PDF]


Home page
J ANIM SCIHome page
C. C. Carr, J. B. Morgan, E. P. Berg, S. D. Carter, and F. K. Ray
Growth performance, carcass composition, quality, and enhancement treatment of fresh pork identified through deoxyribonucleic acid marker-assisted selection for the Rendement Napole gene
J Anim Sci, April 1, 2006; 84(4): 910 - 917.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
D. W. Newcom, K. J. Stalder, T. J. Baas, R. N. Goodwin, F. C. Parrish, and B. R. Wiegand
Breed differences and genetic parameters of myoglobin concentration in porcine longissimus muscle
J Anim Sci, August 1, 2004; 82(8): 2264 - 2268.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moeller, S. J.
Right arrow Articles by Irvin, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moeller, S. J.
Right arrow Articles by Irvin, K. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS