| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
,,4
* Departments of Animal Sciences and
and
Veterinary Pathobiology,
and
Division of Nutritional Sciences, University of Illinois at Urbana–Champaign 61801 and
and
Elanco Animal Health, Research and Development, Greenfield, IN 46140
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionImplicationsLiterature Cited |
|---|
Key Words: Antibiotics • Intestine • Microbiota • Pig • 16S rDNA Polymerase Chain Reaction-Denaturing Gradient Gel Electrophoresis • Quantitative Polymerase Chain Reaction
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionImplicationsLiterature Cited |
|---|
). The therapeutic benefits of antibiotics via microbial inhibition are well known (Stokstad et al., 1949; Tollefson et al., 1997), and the beneficial effects of antibiotics on feed efficiency and growth rate have been demonstrated for all major livestock species (Hays, 1991). Four mechanisms have been suggested to underlie the effects of antibiotics on animal growth: 1) inhibition of subclinical infections, 2) reduction of growth-depressing microbial metabolites, 3) reduction of microbial use of nutrients, and 4) enhanced uptake of nutrients through a thinner intestinal wall (Francois, 1962; Visek, 1978; Anderson et al., 1999). Additional information on the effects of antimicrobial growth promoters on the pig intestinal microbiota is needed to distinguish the relative contribution of these mechanisms. The introduction of higher resolution molecular techniques has improved the analysis of complex microbial populations, such as the intestinal microbiota (Amann et al., 1995; Muyzer and Smalla, 1998; Muyzer et al., 1998; McCracken et al., 2001; Simpson et al., 1999). For example, 16S rDNA denaturing gradient gel electrophoresis (DGGE) is a PCR-based technique in which DNA is isolated from a mixed community sample and amplified using conserved 16S rDNA bacteria-domain primers. Here, PCR-DGGE and quantitative PCR (qPCR) of V3 16S rDNA were used to examine the in vivo effects of antibiotic treatment on the ileal microbiota of ileal-cannulated pigs. |
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionImplicationsLiterature Cited |
|---|
Fifteen crossbred pigs (BW = 13 ± 2 kg; PIC 326 sire line x C22 dams; PIC, Franklin, KY) surgically fitted with a simple T-cannula at the distal ileum according to procedures of Wubben et al. (2001) were housed in individual crates. Before use of halothane anesthesia, the pigs were sedated with an intramuscular mixture of TKX (telazol, tiletamine HCL, and zolazepan HCl; ketamine HCl; and xylazine HCl; all from Fort Dodge Animal Health, Fort Dodge, IA). All experimental procedures were approved by the University of Illinois Institutional Animal Care and Use Committee (Protocol No. 99373).
After surgery, pigs were fed the control diet without antibiotic supplementation for 7 d before the initiation of the experiment. Pigs were initially fed on the basis of 0.09 x BW0.75, and the feeding level was increased 150 g in each subsequent week during the 5-wk experimental period. The pigs were fed twice daily (0800 and 2000; equal portions at each meal), one of three experimental diets (Table 1) over the 5-wk period. Water was provided for ad libitum consumption from a low-pressure drinking nipple.
|
) were formulated to meet or exceed the nutrient requirements of pigs 15 to 35 kg in weight as outlined by NRC (1988), and included the following. 1) A control diet without antibiotics (n = 5); 2) a continuous supplementation of the macrolide antibiotic tylosin phosphate (Elanco Animal Health, Greenfield, IN; inhibits protein synthesis in gram-positive bacteria) at 40 g/ton, as per the manufacturer’s recommended dose for growth promotion (n = 5); and 3) a weekly antibiotic rotation diet (n = 5) as follows: wk 1, 250 g/ton chlorotetracycline sulfathiazole penicillin (CSP-250; Boehringer Ingelheim, St. Joseph, MO; inhibits gram-positive cell wall synthesis); wk 2, 30 g/ton bacitracin (inhibits gram-positive cell wall synthesis) + 4 g/ton of the anticoccidial roxarsone (BMD/3-Nitro, Alpharma, Fort Lee, NJ); wk 3, 20 g/ton lincomycin (Upjohn, Kalamazoo, MI; inhibits gram-positive protein snythesis); wk 4, 25 g/ton carbadox (Mecadox-10, Pfizer Animal Health, NY, NY; broad-spectrum DNA synthesis inhibitor); and wk 5, 10 g/ton virginiamycin (Stafac 20, Pfizer Animal Health; inhibits gram-positive protein synthesis). Each experimental period lasted 7 d, and ileal digesta collection occurred on d 7 of each period. Digesta were collected continuously from 0800 to 2000 via the T-cannula into polyethylene tubing (5 cm x 25 cm; Rand Materials Handling Equipment, Pawtucket, RI) that was emptied every hour into plastic containers and stored at -20°C until the end of collection, at which time they were stored at -80°C until analysis. All pigs were necropsied at d 35, when luminal contents were taken directly from a 2-cm section excised from the mid-ileum (defined by continuous Peyer’s patch), which was slightly anterior of the cannulation site. All samples were snap-frozen in liquid nitrogen and stored at -80°C until analysis.
Genomic DNA Extraction.
Genomic DNA was isolated from all ileal samples from 200 mg of luminal contents using a previously described phenol extraction method (Tsai and Olsen, 1992; Wilson and Blitchington, 1996).
PCR-DGGE.
For PCR-DGGE analysis of total bacteria, each DNA sample was standardized to 20 µg/mL and then amplified using primers specific for conserved sequences flanking the variable V3 region of 16S rDNA (341F: 5' CACGGG GGGGCCTACGGGAGGCAGCAG 3' + 5' 40 nucleotide GC clamp and 534R: 5' ATTACCGCGGTGCTGG 3'), as described previously (Muyzer et al., 1998). To reduce spurious PCR products, touchdown PCR was performed as described by Muyzer and Smalla (1988). After visual confirmation of the PCR products with agarose gel electrophoresis, DGGE was performed using the Bio-Rad D-code system (Hercules, CA) as described previously (Simpson et al., 1999). To separate PCR fragments, 35 to 60% linear DNA-denaturing gradients (100% denaturant is equivalent to 7 mol/L urea and 40% deionized formamide) were formed in 8% polyacrylamide gels using a Bio-Rad Gradient Former. Bacterial V3 16S PCR products were loaded in each lane and electrophoresis performed at 60°C at 150 V for 2 h and then for 1 h at 200 V. Additionally, bacterial reference ladders representing known bacterial strains were loaded to allow standardization of band migration and gel curvature among different gels (Simpson et al., 1999). The reference ladder comprised the following species, listed in order from the top of the gel to the bottom: Bacteroides fragilis, B. thetaiotaomicron, Desulfovibrio vulgaris, Streptococcus bovis, Escherichia coli, Ruminococcus albus 7, D. desulfuricans, Clostridium perfringens, R. albus 8, and Fibrobacter succinogenes. After electrophoresis, gels were silver-stained and scanned using a GS-710 calibrated imagining densitometer (BioRad). Each individual amplicon was then visualized as a distinct band representing at least one bacterial species on the gel.
When antibiotic-dependent differences in PCR-DGGE banding profiles were observed, distinguishing bands were excised, reamplified as described for PCR-DGGE, cloned using a TOPO TA cloning kit (InVitrogen, Carlsbad, CA), and sequenced using an automated sequencing system (Applied Biosystems, Foster City, CA) at the W. M. Keck Center for Comparative and Functional Genomics, University of Illinois Biotechnology Center (Urbana, IL). Sequence data were analyzed using Sequencher 3.0 (Gene Codes, Ann Arbor, MI) and a basic local alignment search tool (http://www.ncbi.nlm.nih.gov/BLAST/) search was performed to identify sequences.
Estimates of Microbial Richness and Diversity.
Diversity Database (Version 2.1) of the "Discovery Series" (BioRad) was used to analyze PCR-DGGE banding patterns by measuring migration distance and intensity of the bands within each lane of a gel (Simpson et al., 2000). This information was then used to analyze banding patterns via measures of community diversity, including band number and Sorenson’s pairwise similarity (Cs) (Sneath and Sokal, 1973; Magurran, 1988). These indices measure ecological diversity using such parameters as species richness (the number of different species) and evenness (the distribution of individual species in the ecosystem) (Magurran, 1988).
Band number corresponds to the number of individual bands in a single gel lane. Sorenson’s pairwise similarity coefficient Cs, sometimes referred to as the dice coefficient, is a similarity index used to compare species composition of different ecosystems (Sheehan, 1984; Magurran, 1988; Gillan et al., 1998). Two identical profiles create a Cs value of 100%, whereas completely different profiles (no common bands) result in a Cs value of 0%. For this comparison, the banding pattern for each sample was compared to the other members in the same treatment group (intragroup) and to each other group (intergroup), allowing comparisons of ileal bacterial populations.
Analysis of Lactobacillus sp. Colonization by Real-Time Quantitative PCR.
A quantitative real-time PCR-based method was developed to specifically measure lactobacilli concentrations in the luminal contents of the pig ileum. Genomic DNA from ileal lumen samples were used as templates for PCR amplification in a GeneAmp 5700 Sequence Detection System (Applied Biosystems) using a Lactobacillus sp.-specific 16S rDNA primer (Lab-0159; GGAAACAG(A/G)TGCTAATACCG 3'), together with a universal primer (Univ-0515; ATCGTATTACCGCGGCTGCTGGCA 3'; Heilig et al., 2002). To assess the total concentration of bacterial DNA, 16S V3 rDNA fragments were amplified with the 534R and 341F primers without the additional 5' 40 nucleotide GC clamp. The standard amplification protocol of Deplancke et al. (2002) was followed. However, for the amplification of the 356-bp rDNA fragment of lactobacilli, the elongation step was changed from 76° for 1 m to 72° for 1 m. Amplificativon was performed in a 25-µL final volume containing 2x SYBR Green PCR Master Mix (Applied Biosystems), 0.5 µM (each) primer, and 5 µL DNA template. For both primer sets, a standard curve was generated with Lactobacillus genomic DNA. The DNA concentrations used were, respectively, 10, 100, and 1000 pg/µL, and these concentrations were plotted against the CT value. The CT value represents the threshold cycle, or the PCR cycle at which an increase in fluorescence from SYBR Green, generated via the binding of SYBR Green to double-stranded DNA, above a baseline signal (derived from samples without DNA template) can first be detected. The GeneAmp 5700 Sequence Detection System (Applied Biosystems) then generates a standard curve vs. log DNA concentration for all standards and determines the DNA concentration of unknowns by interpolation. All standards and unknowns from mucosal and luminal contents from the ileum are expressed as the average percentage of Lactobacillus sp. rDNA relative to total bacterial rDNA.
Statistical Analysis.
Analysis of diversity and similarity indices was performed using SAS (Version 6.09; SAS Institute, Cary, NC). The General Linear Model procedure was used to compare differences according to antibiotic treatment for all indices. Specific antibiotic treatment effects were determined by the least significant difference test with an assigned P-value of <0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionImplicationsLiterature Cited |
|---|
Ileal samples collected from individual pigs on d 0, 7, 14, 21, 28, and 35 of antibiotic treatment were used for PCR-DGGE of the V3 region of 16S rDNA.. Each gel contained all samples from the three treatments for each day. Results from d 14 are presented in Figure 1 as a representative gel image. Diversity Database software was used to analyze PCR-DGGE banding patterns. The effects of antibiotic regimen on numbers of 16S rDNA PCR-DGGE bands (amplicons) in each sample were compared (Figure 2). By d 7 (wk 1), band numbers did not differ (P > 0.05) between treatment groups and did not differ from d 0 (P > 0.05). By d 14, fewer (P < 0.05) bands were observed for pigs treated with tylosin and rotation compared to the control group. Further, band numbers at d 14 for tylosin- and rotation-treated animals were lower (P < 0.05) than on d 0 and 7 in their respective treatments. The number of bands in tylosin-treated pigs then increased such that band numbers were not different (P > 0.05) between the tylosin and control treatments by d 21 (after 3 wk of treatment) and continuing to d 35. However, the number of bands continued to be lower (P < 0.05) at d 28 and 35 in rotation-treated pigs than in control pigs. The number of bands in control pigs remained constant (P > 0.05) throughout the 5-wk period (Figure 2).
|
|
. Intragroup Cs values (comparison across samples within a treatment; Figure 3A) did not differ (P > 0.05) between treatments at d 0 or 7. At d 14, and continuing through d 28, the intragroup Cs values of tylosin- and rotation-treated pigs were greater (P < 0.05) than those of control, but did not differ (P > 0.05) from each other, indicating that antibiotic treatment increased the homogeneity of ileal microbial populations. At d 0 and 7, Cs values for intergroup comparisons of samples across treatments did not differ (P > 0.05) from each other (Figure 3B). At d 14 and 21, Cs values based on comparisons of tylosin and antibiotic rotation treatments vs. the controls were both lower (P < 0.05) than the intergroup comparison between tylosin and antibiotic rotation treatments, indicating that the microbiota was similar between the antibiotic treatments but different from the controls. At d 28 and 35, Cs values based on intergroup comparisons between antibiotic rotation samples vs. both control- and tylosin-fed pigs were decreased (P < 0.05) relative to the comparisons between tylosin vs. control treatments. Therefore, antibiotic rotation continued to select for a unique microbiota from that of the controls at d 28 and 35 whereas tylosin did not.
|
Six 16S rDNA-V3 bands determined by visual inspection to be differentially affected by tylosin or antibiotic rotation treatments were excised from d 7, 14, 21, and 28 PCR-DGGE gels harboring ileal luminal samples, and sequenced for phylogenetic identification (representative bands labeled in Figure 1). Several PCR-DGGE bands occurred more frequently in certain treatment groups (summarized in Table 2). For example, L. gasseri was present at d 7 in four of the five tylosin-treated pigs but not detected in rotation and control-fed pigs. Bands identified in control samples as L. crispatus (d 28 to 35) and an unknown Lactobacillus sp. (d 21 to 35) were not detected in three of the five pigs treated with tylosin, and three of the five pigs treated with the antibiotic rotation. Lactobacillus johnsonii (d 28 to 35), Streptococcus infantarius (d 21 to 35) and a Bacillus sp. (d 28 to 35) were absent in three of five pigs treated with the antibiotic rotation but present in controls.
|
A quantitative real-time, PCR-based method was used to specifically measure total Lactobacillus concentrations as a percentage of total bacteria (Figure 4). Both Lactobacillus-specific and the bacterial-specific primers yielded one band of the correct size, respectively, 356 bp for Lactobacillus amplicons and 220 bp for bacteria-specific amplicons when visualized on an agarose gel (Figure 4A). Regression values for the Lactobacillus-specific primers and the bacterial primer set when log DNA concentrations were plotted against CT values were both 0.99 as determined by serial dilution of Lactobacillus DNA in the concentration range of 10 to 1000 pg/µL. Total 16S rDNA bacterial populations were diminished (P < 0.05) by tylosin and antibiotic rotation treatments relative to controls at d 14 and 21 (Figure 4B). The antibiotic rotation continued to suppress the total bacterial population at d 28 and 35, whereas tylosin did not (Figure 4C). The percentage of Lactobacillus species was greater (P < 0.05) in tylosin-treated pigs at d 14 through 35 relative to rotation-treated and control pigs (Figure 4D).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionImplicationsLiterature Cited |
|---|
Ileal bacterial concentrations, as estimated by 16S rDNA qPCR of total bacteria (1.5 x 109 per gram of contents), were similar to those reported previously for culturable bacteria from the last third of the pig small intestine (Jensen and Jørgensen, 1994). Here, tylosin and the antibiotic rotation both initially decreased total bacterial populations and selected for an ileal microbiota that was relatively homogeneous among similarly treated pigs and distinct from the microbiota of control pigs. These effects reflect, in part, a selection against three Lactobacillus species as well as a Bacillus and a Streptococcus species. Similar results were demonstrated via 16S rDNA PCR-DGGE and culture-based analyses by Knarreborg et al. (2002), whereby they determined that lactobacilli were among the bacterial groups most often diminished by antibiotic administration. Lactobacilli and streptococci are thought to predominate in the upper small intestine, whereas the distal small intestine (ileum) maintains a more diverse microbiota (Fewins, 1957). Therefore, due to the prevalence of lactobacilli and streptococci within the small intestine where the majority of nutrient absorption occurs, the alteration of these bacteria is a potentially important mechanism whereby antibiotics affect animal growth. Also, the antibiotic-induced homogenization of the microbiota observed here may explain, in part, the homogenized growth performance commonly observed in animals fed antimicrobial growth promoters (Schwarz et al., 2001). At the least, the data indicate the need to determine the extent to which microbial populations vary among individual pigs throughout the production life cycle, relative to growth performance. Microbial homogenization may ultimately prove to be a target mechanism for alternatives to antimicrobial growth promoters. However, the PCR-DGGE procedure used here is limited to threshold detection limits of at least 107 to 108 cfu (Simpson et al., 1999). The PCR amplicons of multiple organisms may also migrate to the same position on the gel, resulting in a single band (Simpson et al., 1999). Based on these limitations, other potentially important antibiotic effects may not have been detected.
Previous culture-based studies have demonstrated that small intestinal bacteria compete with the host for energy and amino acids while also producing toxic metabolites, such as vasoactive amines, ammonia, phenols, and indoles (Hedde and Lindsey, 1986; Macfarlane and Macfarlane, 1997). For example, bacterial use of glucose produces lactic acid, which reduces the energy available to the host epithelium, resulting in a loss of as much as 6% of the net energy in pig diets (Vervaeke et al., 1979; Saunders and Sillery, 1982). Additionally, bacterial lactate production increases the rate of nutrient transit through the intestine by increasing peristalsis (Saunders and Sillery, 1982). Dietary energy can also be lost via deconjugation and dehydroxylation of bile by microbial bile salt hydrolase (BSH) production, resulting in impaired lipid absorption by the host animal and production of toxic secondary bile salts (De Somer et al., 1963; Eyssen, 1973; De Boever, 2000). Indeed, the inhibition of bile acid biotransformation in the gut is proposed as an important mechanism whereby antibiotics enhance animal growth (Visek, 1978; Feighner and Dashkevicz, 1987, 1988). Lactobacilli may be largely responsible for intestinal BSH activity (De Smet et al., 1995). Specifically, BSH activity in ileal contents of conventional mice was decreased 86% by the elimination of lactobacilli from the microbiota (Tannock et al., 1989). Therefore, nutrient availability may be improved with a concomitant decrease in toxic metabolites derived from microbial metabolism in antibiotic-treated pigs.
The antibiotic rotation regimen continually suppressed the growth of the small intestinal microbiota in general, including several gram-positive species as identified from the present sequence analysis. This outcome increased microbial homogeneity in the small intestine of pigs treated with the antibiotic rotation. Tylosin also decreased total bacterial concentrations after 2 wk of treatment and through d 21; however, this effect did not continue through d 35. The latter outcome may reflect the replacement of antibiotic-susceptible strains with antibiotic-resistant organisms (Onishi et al., 1974; Morelli et al., 1988; Baquero et al., 1998). Chronic subtherapeutic tylosin administration to pigs resulted in tylosin resistance and also cross-resistance to other macrolides, lincosamidines, and streptogramines (Knothe, 1977). Antibiotics not only select for resistant strains, but can also independently facilitate the transfer of resistance genes to other bacteria (Salyers and Shoemaker, 1996). Cumulatively, these effects can diminish the effectiveness of therapeutic antibiotic use, and, therefore, the potential selection for and transferal of antibiotic-resistant organisms from the pig to humans remains a critical concern.
The qPCR data also indicate that although tylosin decreased total bacterial populations, the concentration of lactobacilli as a percentage of total bacteria was greater in tylosin-treated than control and antibiotic rotation-treated pigs. Similar results were observed in young chicks fed 100 ppm tylosin in which L. gasseri was found only in tylosin-treated birds (Collier et al., 2003). Although tylosin is generally effective against gram-positive bacteria (O’Connor, 1980; Lawrence, 1998), L. gasseri has been found to be particularly resistant to tylosin but still susceptible to virginiamycin (Nagaraja and Taylor, 1987; Felton et al., 1999). Virginiamycin was administered during the second week of the rotation treatment in the present study, potentially explaining the differential effects of the antibiotic rotation vs. tylosin on Lactobacillus population density. The apparent selection of lactobacilli by tylosin is particularly intriguing due to growing interest in and clear justification for the use of lactobacilli as probiotics, despite their potentially detrimental effects on the host (McCracken and Gaskins, 1999; Reid, 1999; Reid et al., 2003). Probiotics suppress the growth of pathogenic bacteria by actively consuming limiting nutrients and via the production of multiple bacteriocins (Cleveland et al., 2001). Also, although potentially energetically costly for the host, Lactobacillus-mediated mucus production enhances the epithelial barrier against pathogenic organisms (Mack et al., 1999; Madsen et al., 2001).
|
Implications |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionImplicationsLiterature Cited |
|---|
|
Footnotes |
|---|
2 Present address: South Dakota State University, Box 2170, Brookings 57007.
3 Present address: Unifeed, 2131-121 Ave., Edmonton, Alberta, Canada, T65-1B2.
4 Correspondence: 1207 West Gregory Drive, Urbana (phone: 217-244-2165; fax: 217-333-8804; E-mail: hgaskins{at}uiuc.edu).
Received for publication April 27, 2003. Accepted for publication August 18, 2003.
|
Literature Cited |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionImplicationsLiterature Cited |
|---|
from Lactobacillus reuteri to Enterococcus faecalis. J. Appl. Bacteriol. 65:371–375.[Medline]
This article has been cited by other articles:
|
|
 |
|
  K. A. Barry, D. C. Hernot, I. S. Middelbos, C. Francis, B. Dunsford, K. S. Swanson, and G. C. Fahey Jr. Low-level fructan supplementation of dogs enhances nutrient digestion and modifies stool metabolite concentrations, but does not alter fecal microbiota populations J Anim Sci, October 1, 2009; 87(10): 3244 - 3252. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Rettedal, S. Vilain, S. Lindblom, K. Lehnert, C. Scofield, S. George, S. Clay, R. S. Kaushik, A. J. M. Rosa, D. Francis, et al. Alteration of the Ileal Microbiota of Weanling Piglets by the Growth-Promoting Antibiotic Chlortetracycline Appl. Envir. Microbiol., September 1, 2009; 75(17): 5489 - 5495. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. G. Manzanilla, J. F. Perez, M. Martin, J. C. Blandon, F. Baucells, C. Kamel, and J. Gasa Dietary protein modifies effect of plant extracts in the intestinal ecosystem of the pig at weaning J Anim Sci, June 1, 2009; 87(6): 2029 - 2037. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Nakamura, H. R. Gaskins, C. T. Collier, G. M. Nava, D. Rai, B. Petschow, W. M. Russell, C. Harris, R. I. Mackie, J. L. Wampler, et al. Molecular Ecological Analysis of Fecal Bacterial Populations from Term Infants Fed Formula Supplemented with Selected Blends of Prebiotics Appl. Envir. Microbiol., February 15, 2009; 75(4): 1121 - 1128. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. A. Santos Jr., P. R. Ferket, F. B. O. Santos, N. Nakamura, and C. Collier Change in the Ileal Bacterial Population of Turkeys Fed Different Diets and After Infection with Salmonella as Determined with Denaturing Gradient Gel Electrophoresis of Amplified 16S Ribosomal DNA Poult. Sci., July 1, 2008; 87(7): 1415 - 1427. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. D. Fastinger, L. K. Karr-Lilienthal, J. K. Spears, K. S. Swanson, K. E. Zinn, G. M. Nava, K. Ohkuma, S. Kanahori, D. T. Gordon, and G. C. Fahey Jr A Novel Resistant Maltodextrin Alters Gastrointestinal Tolerance Factors, Fecal Characteristics, and Fecal Microbiota in Healthy Adult Humans J. Am. Coll. Nutr., April 1, 2008; 27(2): 356 - 366. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Zhou, J. Gong, J. T. Brisbin, H. Yu, B. Sanei, P. Sabour, and S. Sharif Appropriate Chicken Sample Size for Identifying the Composition of Broiler Intestinal Microbiota Affected by Dietary Antibiotics, Using the Polymerase Chain Reaction-Denaturing Gradient Gel Electrophoresis Technique Poult. Sci., December 1, 2007; 86(12): 2541 - 2549. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. S. Middelbos, M. R. Godoy, N. D. Fastinger, and G. C. Fahey Jr. A dose-response evaluation of spray-dried yeast cell wall supplementation of diets fed to adult dogs: Effects on nutrient digestibility, immune indices, and fecal microbial populations J Anim Sci, November 1, 2007; 85(11): 3022 - 3032. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. Agudelo, M. D. Lindemann, G. L. Cromwell, M. C. Newman, and R. D. Nimmo Virginiamycin improves phosphorus digestibility and utilization by growing-finishing pigs fed a phosphorus-deficient, corn-soybean meal diet J Anim Sci, September 1, 2007; 85(9): 2173 - 2182. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. J. Apanavicius, K. L. Powell, B. M. Vester, L. K. Karr-Lilienthal, L. L. Pope, N. D. Fastinger, M. A. Wallig, K. A. Tappenden, and K. S. Swanson Fructan Supplementation and Infection Affect Food Intake, Fever, and Epithelial Sloughing from Salmonella Challenge in Weanling Puppies J. Nutr., August 1, 2007; 137(8): 1923 - 1930. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. E. Hume, S. Clemente-Hernandez, and E. O. Oviedo-Rondon Effects of Feed Additives and Mixed Eimeria Species Infection on Intestinal Microbial Ecology of Broilers Poult. Sci., December 1, 2006; 85(12): 2106 - 2111. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Castillo, S. M. Martin-Orue, M. Roca, E. G. Manzanilla, I. Badiola, J. F. Perez, and J. Gasa The response of gastrointestinal microbiota to avilamycin, butyrate, and plant extracts in early-weaned pigs J Anim Sci, October 1, 2006; 84(10): 2725 - 2734. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. J. Dumonceaux, J. E. Hill, S. M. Hemmingsen, and A. G. Van Kessel Characterization of Intestinal Microbiota and Response to Dietary Virginiamycin Supplementation in the Broiler Chicken Appl. Envir. Microbiol., April 1, 2006; 72(4): 2815 - 2823. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Owusu-Asiedu, J. F. Patience, B. Laarveld, A. G. Van Kessel, P. H. Simmins, and R. T. Zijlstra Effects of guar gum and cellulose on digesta passage rate, ileal microbial populations, energy and protein digestibility, and performance of grower pigs J Anim Sci, April 1, 2006; 84(4): 843 - 852. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Hojberg, N. Canibe, H. D. Poulsen, M. S. Hedemann, and B. B. Jensen Influence of Dietary Zinc Oxide and Copper Sulfate on the Gastrointestinal Ecosystem in Newly Weaned Piglets Appl. Envir. Microbiol., May 1, 2005; 71(5): 2267 - 2277. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. G. Manzanilla, J. F. Perez, M. Martin, C. Kamel, F. Baucells, and J. Gasa Effect of plant extracts and formic acid on the intestinal equilibrium of early-weaned pigs J Anim Sci, November 1, 2004; 82(11): 3210 - 3218. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
